Rh1AG436200
ERF Family

BEST Arabidopsis thaliana protein match is F-box RNI-like superfamily protein (TAIR

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0022076
Physical Location & Seq
Reverse (-)
66073811 .. 66074185
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG436200.1

Sequence Viewer

Length: 375 bp
ATGGCTGATGAAGAAGACAACAGAGTTAGAAGCCAGAGTGATTTACCCGATAATGTTCTTGGCCACGTCTTATCCTTTCTACCAACAGAAGAAGCCTCTAGAACGAGCATATTATCAAAAAGTTGGCGATACTTATGGTCATTGACTCCCAACCTTGACTTGGATGATCAAAGAGCCTATAACCCTAACAATTACTTAACACACTCGACAAATCTCCTCTTCGAAAATTCACCAAGAGCTTCCATCTCAAATTCAGCATTTATGATGATCGATCGAATCGACATGATGTCTCTTCCTTGGAGTCTTGGATCACTGGTCTGGTTAAGCGTAACGTTGAAGCTGTATCACTATCTCTACATATACACCGGCGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

124

Amino Acids

14.37

Weight (kDa)

4.88

Isoelectric Point (pI)

40.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 13 - 47 1.5e-08 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022076)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47915 AT3G12840
rosa_roxburghii Rroxscaffold_7G00212870
rosa_samantha Rh1AG436200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 332
AclWI GGATC 1 cut(s) 316
AcoI YGGCCR 1 cut(s) 61
AcsI RAATTY 2 cut(s) 226, 250
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 1 cut(s) 337
AhdI GACNNNNNGTC 1 cut(s) 286
AjiI CACGTC 1 cut(s) 67
AluBI AGCT 2 cut(s) 239, 340
AluI AGCT 2 cut(s) 239, 340
Alw26I GTCTC 1 cut(s) 294
AlwI GGATC 1 cut(s) 316
AoxI GGCC 1 cut(s) 61
ApoI RAATTY 2 cut(s) 226, 250
AsuHPI GGTGA 1 cut(s) 222
AsuII TTCGAA 1 cut(s) 222
BalI TGGCCA 1 cut(s) 63
BbsI GAAGAC 1 cut(s) 21
BccI CCATC 1 cut(s) 251
BclI TGATCA 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 294
BfaI CTAG 1 cut(s) 99
BmeRI GACNNNNNGTC 1 cut(s) 286
BmgBI CACGTC 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 21
Bpu14I TTCGAA 1 cut(s) 222
Bsa29I ATCGAT 1 cut(s) 270
BsaJI CCNNGG 1 cut(s) 296
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse118I RCCGGY 1 cut(s) 365
Bse1I ACTGG 1 cut(s) 318
BseCI ATCGAT 1 cut(s) 270
BseDI CCNNGG 1 cut(s) 296
BseGI GGATG 1 cut(s) 169
BseLI CCNNNNNNNGG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 318
BseRI GAGGAG 1 cut(s) 206
Bsh1285I CGRYCG 1 cut(s) 274
BshFI GGCC 1 cut(s) 63
BshVI ATCGAT 1 cut(s) 270
BsiEI CGRYCG 1 cut(s) 274
BsiSI CCGG 1 cut(s) 366
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 294
BsnI GGCC 1 cut(s) 63
Bsp119I TTCGAA 1 cut(s) 222
Bsp143I GATC 4 cut(s) 166, 267, 271, 308
BspANI GGCC 1 cut(s) 63
BspDI ATCGAT 1 cut(s) 270
BspPI GGATC 1 cut(s) 316
BspT104I TTCGAA 1 cut(s) 222
BsrFI RCCGGY 1 cut(s) 365
BsrI ACTGG 1 cut(s) 318
BssAI RCCGGY 1 cut(s) 365
BssECI CCNNGG 1 cut(s) 296
BssMI GATC 4 cut(s) 166, 267, 271, 308
BssT1I CCWWGG 1 cut(s) 296
Bst6I CTCTTC 2 cut(s) 224, 297
BstBI TTCGAA 1 cut(s) 222
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 4 cut(s) 169, 270, 274, 311
BstMAI GTCTC 1 cut(s) 294
BstMBI GATC 4 cut(s) 166, 267, 271, 308
BstMCI CGRYCG 1 cut(s) 274
BstV2I GAAGAC 1 cut(s) 21
Bsu15I ATCGAT 1 cut(s) 270
BsuRI GGCC 1 cut(s) 63
BsuTUI ATCGAT 1 cut(s) 270
BtrI CACGTC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 169
BtsIMutI CAGTG 1 cut(s) 311
Cfr10I RCCGGY 1 cut(s) 365
ClaI ATCGAT 1 cut(s) 270
CviAII CATG 1 cut(s) 283
CviJI RGCY 7 cut(s) 5, 33, 63, 95, 176, 239, 340
CviKI_1 RGCY 7 cut(s) 5, 33, 63, 95, 176, 239, 340
DpnI GATC 4 cut(s) 168, 269, 273, 310
DpnII GATC 4 cut(s) 166, 267, 271, 308
DriI GACNNNNNGTC 1 cut(s) 286
EaeI YGGCCR 1 cut(s) 61
Eam1104I CTCTTC 2 cut(s) 224, 297
Eam1105I GACNNNNNGTC 1 cut(s) 286
EarI CTCTTC 2 cut(s) 224, 297
Eco130I CCWWGG 1 cut(s) 296
EcoT14I CCWWGG 1 cut(s) 296
ErhI CCWWGG 1 cut(s) 296
FaeI CATG 1 cut(s) 286
FaiI YATR 7 cut(s) 110, 136, 180, 263, 284, 359, 361
FatI CATG 1 cut(s) 282
FbaI TGATCA 1 cut(s) 166
FokI GGATG 1 cut(s) 176
FspBI CTAG 1 cut(s) 99
HaeIII GGCC 1 cut(s) 63
HapII CCGG 1 cut(s) 366
Hin1II CATG 1 cut(s) 286
HinfI GANTC 3 cut(s) 145, 276, 301
HpaII CCGG 1 cut(s) 366
HphI GGTGA 1 cut(s) 222
Hpy188III TCNNGA 1 cut(s) 99
HpyCH4IV ACGT 2 cut(s) 66, 332
HpySE526I ACGT 2 cut(s) 66, 332
Hsp92II CATG 1 cut(s) 286
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 4 cut(s) 166, 267, 271, 308
LpnPI CCDG 3 cut(s) 47, 299, 304
MaeI CTAG 1 cut(s) 99
MaeII ACGT 2 cut(s) 66, 332
MaeIII GTNAC 1 cut(s) 328
MalI GATC 4 cut(s) 168, 269, 273, 310
MboI GATC 4 cut(s) 166, 267, 271, 308
MboII GAAGA 5 cut(s) 23, 26, 101, 211, 284
MlsI TGGCCA 1 cut(s) 63
MluCI AATT 3 cut(s) 190, 226, 250
MluNI TGGCCA 1 cut(s) 63
MlyI GAGTC 2 cut(s) 139, 310
MnlI CCTC 2 cut(s) 106, 227
Mox20I TGGCCA 1 cut(s) 63
MscI TGGCCA 1 cut(s) 63
MseI TTAA 2 cut(s) 197, 323
Msp20I TGGCCA 1 cut(s) 63
MspI CCGG 1 cut(s) 366
NdeII GATC 4 cut(s) 166, 267, 271, 308
NlaIII CATG 1 cut(s) 286
NspV TTCGAA 1 cut(s) 222
PcsI WCGNNNNNNNCGW 1 cut(s) 276
PfeI GAWTC 1 cut(s) 276
Ple19I CGATCG 1 cut(s) 274
PleI GAGTC 2 cut(s) 139, 309
PpsI GAGTC 2 cut(s) 139, 309
Psp1406I AACGTT 1 cut(s) 332
PvuI CGATCG 1 cut(s) 274
SaqAI TTAA 2 cut(s) 197, 323
Sau3AI GATC 4 cut(s) 166, 267, 271, 308
SchI GAGTC 2 cut(s) 139, 310
SetI ASST 5 cut(s) 69, 156, 241, 335, 342
SfuI TTCGAA 1 cut(s) 222
SgrAI CRCCGGYG 1 cut(s) 365
Sse9I AATT 3 cut(s) 190, 226, 250
SspMI CTAG 1 cut(s) 99
StyI CCWWGG 1 cut(s) 296
TaiI ACGT 2 cut(s) 69, 335
TaqI TCGA 5 cut(s) 206, 222, 270, 274, 279
TasI AATT 3 cut(s) 190, 226, 250
TfiI GAWTC 1 cut(s) 276
Tru1I TTAA 2 cut(s) 197, 323
Tru9I TTAA 2 cut(s) 197, 323
TscAI CASTG 1 cut(s) 318
TspDTI ATGAA 1 cut(s) 24
TspRI CASTG 1 cut(s) 318
XapI RAATTY 2 cut(s) 226, 250
XbaI TCTAGA 1 cut(s) 98
XcmI CCANNNNNNNNNTGG 1 cut(s) 157
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.