Rh2AG517900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
74456962 .. 74457569
608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG517900.1

Sequence Viewer

Length: 354 bp
ATGGCAGCCAGGTTGATTCTCTTCCCTCCCACCACAACATTTCTAGGACCCTCAGGCCAATCACCACTATCTACTCTTTCTTTCACTTCCATTTCACCAAAGAGGAGAGCAAACAGTTTCAAGATTCAAGCAGATTTGGGCGGTGGAGATGCAGAAGCAAATAAGGGAGGAAAGAAAAAGTTTATAACTAGAGAACAAGAGCCAGAGCAGTACTGGCAAACAGCAGGAGAAAGAGAAGGAGAAAATCCCATGATGACCCCTCTTCCTTACATCATCATATTTGGCATGTCTACACCTTTTGTCATCTTAGCCATTGCTTTTGCTAATGGTTGGATTAAGGTGCCAGTTCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

12.83

Weight (kDa)

9.69

Isoelectric Point (pI)

52.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011172)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 185
AccB1I GGYRCC 1 cut(s) 340
AccI GTMKAC 1 cut(s) 290
AciI CCGC 1 cut(s) 141
AfaI GTAC 1 cut(s) 212
AgsI TTSAA 2 cut(s) 121, 128
AjnI CCWGG 1 cut(s) 8
AoxI GGCC 1 cut(s) 55
ApeKI GCWGC 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 47
AsuHPI GGTGA 2 cut(s) 54, 87
AvaII GGWCC 1 cut(s) 47
AxyI CCTNAGG 1 cut(s) 52
BanI GGYRCC 1 cut(s) 340
BbvI GCAGC 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 10
BfaI CTAG 2 cut(s) 44, 189
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BmcAI AGTACT 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 10
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 47
BmiI GGNNCC 2 cut(s) 49, 342
BmrFI CCNGG 1 cut(s) 10
BmsI GCATC 1 cut(s) 139
Bse1I ACTGG 2 cut(s) 218, 344
Bse21I CCTNAGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 312
BseBI CCWGG 1 cut(s) 10
BseMI GCAATG 1 cut(s) 312
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 2 cut(s) 218, 344
BseRI GAGGAG 1 cut(s) 118
BseXI GCAGC 1 cut(s) 17
BshFI GGCC 1 cut(s) 57
BshNI GGYRCC 1 cut(s) 340
BsnI GGCC 1 cut(s) 57
BspACI CCGC 1 cut(s) 141
BspANI GGCC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 65
BspLI GGNNCC 2 cut(s) 49, 342
BspT107I GGYRCC 1 cut(s) 340
BsrDI GCAATG 1 cut(s) 312
BsrI ACTGG 2 cut(s) 218, 344
Bst2UI CCWGG 1 cut(s) 10
Bst4CI ACNGT 1 cut(s) 116
Bst6I CTCTTC 2 cut(s) 26, 267
BstDEI CTNAG 2 cut(s) 52, 307
BstMWI GCNNNNNNNGC 1 cut(s) 214
BstNI CCWGG 1 cut(s) 10
BstNSI RCATGY 1 cut(s) 289
BstSCI CCNGG 1 cut(s) 8
BstV1I GCAGC 1 cut(s) 17
Bsu36I CCTNAGG 1 cut(s) 52
BsuRI GGCC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 211
CviAII CATG 2 cut(s) 250, 286
CviJI RGCY 4 cut(s) 8, 57, 202, 311
CviKI_1 RGCY 4 cut(s) 8, 57, 202, 311
CviQI GTAC 1 cut(s) 211
DdeI CTNAG 2 cut(s) 52, 307
Eam1104I CTCTTC 2 cut(s) 26, 267
EarI CTCTTC 2 cut(s) 26, 267
Eco47I GGWCC 1 cut(s) 47
Eco81I CCTNAGG 1 cut(s) 52
EcoO109I RGGNCCY 1 cut(s) 47
EcoRII CCWGG 1 cut(s) 8
FaeI CATG 2 cut(s) 253, 289
FaiI YATR 4 cut(s) 185, 251, 278, 287
FatI CATG 2 cut(s) 249, 285
FblI GTMKAC 1 cut(s) 290
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 2 cut(s) 44, 189
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 57
Hin1II CATG 2 cut(s) 253, 289
HinfI GANTC 2 cut(s) 16, 124
HphI GGTGA 2 cut(s) 54, 87
Hpy166II GTNNAC 1 cut(s) 291
Hpy188III TCNNGA 1 cut(s) 121
Hpy8I GTNNAC 1 cut(s) 291
HpyAV CCTTC 1 cut(s) 230
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpyF3I CTNAG 2 cut(s) 52, 307
Hsp92II CATG 2 cut(s) 253, 289
LpnPI CCDG 5 cut(s) 22, 39, 199, 210, 216
Lsp1109I GCAGC 1 cut(s) 17
LweI GCATC 1 cut(s) 139
MaeI CTAG 2 cut(s) 44, 189
MboII GAAGA 2 cut(s) 13, 254
MmeI TCCRAC 1 cut(s) 311
MnlI CCTC 5 cut(s) 36, 61, 96, 161, 270
MseI TTAA 1 cut(s) 336
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 214
NlaIII CATG 2 cut(s) 253, 289
NlaIV GGNNCC 2 cut(s) 49, 342
NspI RCATGY 1 cut(s) 289
PfeI GAWTC 2 cut(s) 16, 124
PkrI GCNGC 1 cut(s) 7
PpuMI RGGWCCY 1 cut(s) 47
PsiI TTATAA 1 cut(s) 185
Psp5II RGGWCCY 1 cut(s) 47
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspN4I GGNNCC 2 cut(s) 49, 342
PspPI GGNCC 1 cut(s) 47
PspPPI RGGWCCY 1 cut(s) 47
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
SaqAI TTAA 1 cut(s) 336
SatI GCNGC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 47
ScaI AGTACT 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 10
SetI ASST 3 cut(s) 14, 298, 342
SfaNI GCATC 1 cut(s) 139
SinI GGWCC 1 cut(s) 47
SsiI CCGC 1 cut(s) 141
SspMI CTAG 2 cut(s) 44, 189
StyD4I CCNGG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 349
TatI WGTACW 1 cut(s) 210
TfiI GAWTC 2 cut(s) 16, 124
Tru1I TTAA 1 cut(s) 336
Tru9I TTAA 1 cut(s) 336
TseI GCWGC 1 cut(s) 5
VpaK11BI GGWCC 1 cut(s) 47
XceI RCATGY 1 cut(s) 289
XcmI CCANNNNNNNNNTGG 1 cut(s) 210
XmiI GTMKAC 1 cut(s) 290
XspI CTAG 2 cut(s) 44, 189
ZrmI AGTACT 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.