Rh2BG381600

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
53914629 .. 53914979
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG381600.1

Sequence Viewer

Length: 351 bp
ATGCTACAAGTTGTGGAGAGGAATGAAGAAGGAAGGCCAAAACAATGCAGGATGCATGATGTCATGCGTGAGCTTGCTCTTTCAACATCTGAGAAAGAAAAGTTTTGTGCTGTGTATGATGGGAAAGATGAAGCAATTGAAGCCCGCCGTTTGTCATTTCAATTTGAAAGAGAAATTAAATCCAGCACAGGTATATCACAGCTTCGATCTATTCTTGTCTTTGTCAAAGAGACTACGTTGCCTTCTGATTGCAAATTTTTGAGGGTGCTAGACTTGGCGGAGAATATGTCAATAACTAAACTGCTAGATGATCTTGGGTACTTGTTCAACTTAAGATATATATATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.57

Weight (kDa)

5.89

Isoelectric Point (pI)

51.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022685)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0135371
rosa_multiflora Rmu_ssc0000187.1_g000021
rosa_samantha Rh2BG381600 Rh2DG397900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 145, 278
AcsI RAATTY 1 cut(s) 254
AfaI GTAC 1 cut(s) 320
AflII CTTAAG 1 cut(s) 331
AgsI TTSAA 5 cut(s) 84, 140, 161, 167, 328
AluBI AGCT 2 cut(s) 73, 202
AluI AGCT 2 cut(s) 73, 202
Alw26I GTCTC 1 cut(s) 224
AoxI GGCC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 254
BccI CCATC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 224
BfaI CTAG 2 cut(s) 269, 305
BfrI CTTAAG 1 cut(s) 331
BmsI GCATC 1 cut(s) 42
BsaXI ACNNNNNCTCC 2 cut(s) 272, 302
BseGI GGATG 1 cut(s) 57
BseMII CTCAG 1 cut(s) 81
BshFI GGCC 1 cut(s) 37
BsmAI GTCTC 1 cut(s) 224
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 2 cut(s) 206, 310
BspACI CCGC 2 cut(s) 145, 278
BspANI GGCC 1 cut(s) 37
BspCNI CTCAG 1 cut(s) 82
BspTI CTTAAG 1 cut(s) 331
BssMI GATC 2 cut(s) 206, 310
BstAFI CTTAAG 1 cut(s) 331
BstC8I GCNNGC 2 cut(s) 75, 145
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 2 cut(s) 209, 313
BstMAI GTCTC 1 cut(s) 224
BstMBI GATC 2 cut(s) 206, 310
BstMWI GCNNNNNNNGC 1 cut(s) 140
BsuRI GGCC 1 cut(s) 37
BtsCI GGATG 1 cut(s) 57
Cac8I GCNNGC 2 cut(s) 75, 145
Csp6I GTAC 1 cut(s) 319
CviAII CATG 2 cut(s) 56, 64
CviJI RGCY 4 cut(s) 37, 73, 143, 202
CviKI_1 RGCY 4 cut(s) 37, 73, 143, 202
CviQI GTAC 1 cut(s) 319
DdeI CTNAG 1 cut(s) 90
DpnI GATC 2 cut(s) 208, 312
DpnII GATC 2 cut(s) 206, 310
EciI GGCGGA 1 cut(s) 293
EcoT22I ATGCAT 1 cut(s) 57
FaeI CATG 2 cut(s) 59, 67
FaiI YATR 9 cut(s) 57, 65, 117, 194, 287, 339, 341, 343, 345
FatI CATG 2 cut(s) 55, 63
FauI CCCGC 1 cut(s) 152
FokI GGATG 1 cut(s) 64
FspBI CTAG 2 cut(s) 269, 305
HaeIII GGCC 1 cut(s) 37
Hin1II CATG 2 cut(s) 59, 67
Hpy188I TCNGA 2 cut(s) 91, 247
HpyAV CCTTC 3 cut(s) 23, 27, 252
HpyCH4IV ACGT 1 cut(s) 236
HpyCH4V TGCA 3 cut(s) 48, 55, 252
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 90
HpySE526I ACGT 1 cut(s) 236
Hsp92II CATG 2 cut(s) 59, 67
Kzo9I GATC 2 cut(s) 206, 310
LpnPI CCDG 3 cut(s) 34, 174, 196
LweI GCATC 1 cut(s) 42
MaeI CTAG 2 cut(s) 269, 305
MaeII ACGT 1 cut(s) 236
MalI GATC 2 cut(s) 208, 312
MboI GATC 2 cut(s) 206, 310
MboII GAAGA 1 cut(s) 38
MfeI CAATTG 1 cut(s) 135
MluCI AATT 4 cut(s) 135, 161, 174, 254
MnlI CCTC 2 cut(s) 12, 255
Mph1103I ATGCAT 1 cut(s) 57
MseI TTAA 2 cut(s) 177, 332
MspCI CTTAAG 1 cut(s) 331
MunI CAATTG 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 140
NdeII GATC 2 cut(s) 206, 310
NlaIII CATG 2 cut(s) 59, 67
NsiI ATGCAT 1 cut(s) 57
RsaI GTAC 1 cut(s) 320
RsaNI GTAC 1 cut(s) 319
SaqAI TTAA 2 cut(s) 177, 332
Sau3AI GATC 2 cut(s) 206, 310
SetI ASST 4 cut(s) 75, 193, 204, 239
SfaNI GCATC 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 331
SmoI CTYRAG 1 cut(s) 331
Sse9I AATT 4 cut(s) 135, 161, 174, 254
SsiI CCGC 2 cut(s) 145, 278
SspMI CTAG 2 cut(s) 269, 305
TaiI ACGT 1 cut(s) 239
TaqI TCGA 1 cut(s) 205
TasI AATT 4 cut(s) 135, 161, 174, 254
Tru1I TTAA 2 cut(s) 177, 332
Tru9I TTAA 2 cut(s) 177, 332
TspDTI ATGAA 2 cut(s) 39, 144
Vha464I CTTAAG 1 cut(s) 331
XapI RAATTY 1 cut(s) 254
XspI CTAG 2 cut(s) 269, 305
Zsp2I ATGCAT 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.