Rh2DG397900

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
57880509 .. 57881066
558 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG397900.1

Sequence Viewer

Length: 558 bp
ATGCTACAAGTTGTGGAGAGGAATGAAGAAGGAAGGCCAAAACAATGCAGGATGCATGATGTCATGAGTGAGCTTGCTCTTTCAACATCTGAGAAAGAAAAGTTTTGTGCTGTGTATGATGGGAAAGATGAAGCAATTGAAGCCCGCCGTTTGTCATTTCAATTTGAAGGAGAAATTAAATCCAGCACAGGTATATCACAACTTCGATCTATTCTTGTCTTTGTCAAAGAGACTACGTTGCCTTCTGATTGCAAATTTTTGAGGGTGCTAGACTTGGCGGAGAATATGTCAATAACTAAACTGCTAGATGATCTTGGGTACTTGTTCAACTTAAGATATATAAATTTGAGGAGAACTCGTATCAAGGAGCTTCCAAAATCCATAGGAAAGCTACGCAACCATCAAACCTTGAACATCCGCGAAAGTAAGATAAAGGAACTTCCAAAAGAAATTGCCAAGTTGTTAAATCTGCGCCATCTAATTATGTACCATTACACTGATGATTTTCTTGGGTTTAGATTTGTCAAGGGGACAAGAGTACCAGTGGATCTTAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

185

Amino Acids

21.58

Weight (kDa)

9.24

Isoelectric Point (pI)

54.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 67 - 166 1.1e-23 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022685)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0135371
rosa_multiflora Rmu_ssc0000187.1_g000021
rosa_samantha Rh2BG381600 Rh2DG397900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 420
AciI CCGC 3 cut(s) 145, 278, 418
AclWI GGATC 1 cut(s) 555
AcsI RAATTY 2 cut(s) 254, 343
AfaI GTAC 3 cut(s) 320, 488, 540
AflII CTTAAG 1 cut(s) 331
AgsI TTSAA 6 cut(s) 84, 140, 161, 167, 328, 412
AluBI AGCT 3 cut(s) 73, 370, 391
AluI AGCT 3 cut(s) 73, 370, 391
Alw26I GTCTC 1 cut(s) 224
AlwI GGATC 1 cut(s) 555
AoxI GGCC 1 cut(s) 35
ApoI RAATTY 2 cut(s) 254, 343
AspLEI GCGC 1 cut(s) 474
BaeI ACNNNNGTAYC 2 cut(s) 522, 555
BccI CCATC 3 cut(s) 113, 408, 483
BceAI ACGGC 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 224
BfaI CTAG 2 cut(s) 269, 305
BfrI CTTAAG 1 cut(s) 331
BmsI GCATC 1 cut(s) 42
BplI GAGNNNNNCTC 2 cut(s) 340, 372
BsaXI ACNNNNNCTCC 4 cut(s) 272, 302, 343, 373
Bse1I ACTGG 1 cut(s) 542
BseGI GGATG 2 cut(s) 57, 414
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 542
BseRI GAGGAG 1 cut(s) 364
Bsh1236I CGCG 1 cut(s) 420
BshFI GGCC 1 cut(s) 37
BslFI GGGAC 1 cut(s) 544
BsmAI GTCTC 1 cut(s) 224
BsmFI GGGAC 1 cut(s) 544
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 3 cut(s) 206, 310, 547
BspACI CCGC 3 cut(s) 145, 278, 418
BspANI GGCC 1 cut(s) 37
BspCNI CTCAG 1 cut(s) 82
BspFNI CGCG 1 cut(s) 420
BspHI TCATGA 1 cut(s) 63
BspPI GGATC 1 cut(s) 555
BspTI CTTAAG 1 cut(s) 331
BsrI ACTGG 1 cut(s) 542
BssMI GATC 3 cut(s) 206, 310, 547
BstAFI CTTAAG 1 cut(s) 331
BstC8I GCNNGC 2 cut(s) 75, 145
BstDEI CTNAG 2 cut(s) 90, 551
BstF5I GGATG 2 cut(s) 57, 414
BstFNI CGCG 1 cut(s) 420
BstHHI GCGC 1 cut(s) 474
BstKTI GATC 3 cut(s) 209, 313, 550
BstMAI GTCTC 1 cut(s) 224
BstMBI GATC 3 cut(s) 206, 310, 547
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstUI CGCG 1 cut(s) 420
BstX2I RGATCY 1 cut(s) 547
BstYI RGATCY 1 cut(s) 547
BsuRI GGCC 1 cut(s) 37
BtsCI GGATG 2 cut(s) 57, 414
BtsIMutI CAGTG 2 cut(s) 495, 549
Cac8I GCNNGC 2 cut(s) 75, 145
CciI TCATGA 1 cut(s) 63
CfoI GCGC 1 cut(s) 474
Csp6I GTAC 3 cut(s) 319, 487, 539
CviAII CATG 2 cut(s) 56, 64
CviJI RGCY 5 cut(s) 37, 73, 143, 370, 391
CviKI_1 RGCY 5 cut(s) 37, 73, 143, 370, 391
CviQI GTAC 3 cut(s) 319, 487, 539
DdeI CTNAG 2 cut(s) 90, 551
DpnI GATC 3 cut(s) 208, 312, 549
DpnII GATC 3 cut(s) 206, 310, 547
EciI GGCGGA 1 cut(s) 293
EcoT22I ATGCAT 1 cut(s) 57
FaeI CATG 2 cut(s) 59, 67
FaiI YATR 9 cut(s) 57, 65, 117, 194, 287, 339, 341, 383, 485
FaqI GGGAC 1 cut(s) 544
FatI CATG 2 cut(s) 55, 63
FauI CCCGC 1 cut(s) 152
FokI GGATG 2 cut(s) 64, 401
FspBI CTAG 2 cut(s) 269, 305
GlaI GCGC 1 cut(s) 473
HaeIII GGCC 1 cut(s) 37
HhaI GCGC 1 cut(s) 474
Hin1II CATG 2 cut(s) 59, 67
Hin6I GCGC 1 cut(s) 472
HinP1I GCGC 1 cut(s) 472
Hpy188I TCNGA 2 cut(s) 91, 247
Hpy188III TCNNGA 1 cut(s) 64
HpyAV CCTTC 4 cut(s) 23, 27, 161, 252
HpyCH4IV ACGT 1 cut(s) 236
HpyCH4V TGCA 3 cut(s) 48, 55, 252
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 2 cut(s) 90, 551
HpySE526I ACGT 1 cut(s) 236
Hsp92II CATG 2 cut(s) 59, 67
HspAI GCGC 1 cut(s) 472
Kzo9I GATC 3 cut(s) 206, 310, 547
LmnI GCTCC 1 cut(s) 367
LpnPI CCDG 3 cut(s) 34, 174, 196
LweI GCATC 1 cut(s) 42
MaeI CTAG 2 cut(s) 269, 305
MaeII ACGT 1 cut(s) 236
MalI GATC 3 cut(s) 208, 312, 549
MboI GATC 3 cut(s) 206, 310, 547
MboII GAAGA 1 cut(s) 38
MfeI CAATTG 1 cut(s) 135
MflI RGATCY 1 cut(s) 547
MluCI AATT 7 cut(s) 135, 161, 174, 254, 343, 450, 480
MnlI CCTC 3 cut(s) 12, 255, 342
Mph1103I ATGCAT 1 cut(s) 57
MseI TTAA 3 cut(s) 177, 332, 464
MspCI CTTAAG 1 cut(s) 331
MunI CAATTG 1 cut(s) 135
MvnI CGCG 1 cut(s) 420
MwoI GCNNNNNNNGC 1 cut(s) 140
NdeII GATC 3 cut(s) 206, 310, 547
NlaIII CATG 2 cut(s) 59, 67
NsiI ATGCAT 1 cut(s) 57
PagI TCATGA 1 cut(s) 63
PsuI RGATCY 1 cut(s) 547
RsaI GTAC 3 cut(s) 320, 488, 540
RsaNI GTAC 3 cut(s) 319, 487, 539
SaqAI TTAA 3 cut(s) 177, 332, 464
Sau3AI GATC 3 cut(s) 206, 310, 547
SetI ASST 6 cut(s) 75, 193, 239, 372, 393, 410
SfaNI GCATC 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 331
SmoI CTYRAG 1 cut(s) 331
Sse9I AATT 7 cut(s) 135, 161, 174, 254, 343, 450, 480
SsiI CCGC 3 cut(s) 145, 278, 418
SspMI CTAG 2 cut(s) 269, 305
TaiI ACGT 1 cut(s) 239
TaqI TCGA 1 cut(s) 205
TasI AATT 7 cut(s) 135, 161, 174, 254, 343, 450, 480
Tru1I TTAA 3 cut(s) 177, 332, 464
Tru9I TTAA 3 cut(s) 177, 332, 464
TscAI CASTG 2 cut(s) 502, 549
TspDTI ATGAA 2 cut(s) 39, 144
TspRI CASTG 2 cut(s) 502, 549
Vha464I CTTAAG 1 cut(s) 331
XapI RAATTY 2 cut(s) 254, 343
XspI CTAG 2 cut(s) 269, 305
Zsp2I ATGCAT 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.