Rh2BG600900

HEAT repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
82129614 .. 82132335
2722 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG600900.1

Sequence Viewer

Length: 339 bp
ATGGATAATTCATGGGATACTCTTTCAGTGTCTGTTCTATCACAGAACTGCCCTGAAACATTTTATGAGCCAGAACACTCTGCTTATCTGGCAGTGGAACTCTGTTTGGCGTACCTCTACAAAGTGTTTCAAAGTACCAATGCCATATCTCTGGATAACTCCTTGGAGGATTTGATATCCTCAATATTTGTCACAGCAAAATCCATTGTGAACTGTTTTCAACCAAAGAAAGGCACAAATGCGGAGGATGAAACTTTCTTAATGCTTTTTGTTGGGGAACTTGCTAGTGATCTTCTCCTGATAATGCAGAATATATTAAAGAAACCGGCCTGTAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.51

Weight (kDa)

4.3

Isoelectric Point (pI)

33.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022653)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0166401
rosa_rugosa Rorug02G0522700
rosa_samantha Rh2BG600900 Rh2CG571600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 242
AfaI GTAC 2 cut(s) 113, 136
AfiI CCNNNNNNNGG 1 cut(s) 230
AgsI TTSAA 2 cut(s) 131, 221
AlwNI CAGNNNCTG 1 cut(s) 32
AoxI GGCC 1 cut(s) 327
BciVI GTATCC 1 cut(s) 10
BfaI CTAG 1 cut(s) 285
BfuI GTATCC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 230
Bse118I RCCGGY 1 cut(s) 325
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 253
BseLI CCNNNNNNNGG 1 cut(s) 230
BshFI GGCC 1 cut(s) 329
BsiSI CCGG 1 cut(s) 326
BslI CCNNNNNNNGG 1 cut(s) 230
BsnI GGCC 1 cut(s) 329
Bsp143I GATC 1 cut(s) 289
BspACI CCGC 1 cut(s) 242
BspANI GGCC 1 cut(s) 329
BsrFI RCCGGY 1 cut(s) 325
BssAI RCCGGY 1 cut(s) 325
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 1 cut(s) 289
BssT1I CCWWGG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 215
BstF5I GGATG 1 cut(s) 253
BstKTI GATC 1 cut(s) 292
BstMBI GATC 1 cut(s) 289
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstXI CCANNNNNNTGG 1 cut(s) 151
BsuI GTATCC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 329
BtsCI GGATG 1 cut(s) 253
BtsI GCAGTG 1 cut(s) 99
BtsIMutI CAGTG 2 cut(s) 33, 99
CaiI CAGNNNCTG 1 cut(s) 32
Cfr10I RCCGGY 1 cut(s) 325
Csp6I GTAC 2 cut(s) 112, 135
CviAII CATG 1 cut(s) 12
CviJI RGCY 2 cut(s) 70, 329
CviKI_1 RGCY 2 cut(s) 70, 329
CviQI GTAC 2 cut(s) 112, 135
DpnI GATC 1 cut(s) 291
DpnII GATC 1 cut(s) 289
Eco130I CCWWGG 1 cut(s) 162
Eco32I GATATC 1 cut(s) 177
EcoRV GATATC 1 cut(s) 177
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaeI CATG 1 cut(s) 15
FaiI YATR 4 cut(s) 13, 66, 146, 314
FatI CATG 1 cut(s) 11
FokI GGATG 1 cut(s) 260
FspBI CTAG 1 cut(s) 285
HaeIII GGCC 1 cut(s) 329
HapII CCGG 1 cut(s) 326
Hin1II CATG 1 cut(s) 15
HpaII CCGG 1 cut(s) 326
Hpy166II GTNNAC 1 cut(s) 211
Hpy188III TCNNGA 2 cut(s) 152, 298
Hpy8I GTNNAC 1 cut(s) 211
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 1 cut(s) 307
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92II CATG 1 cut(s) 15
Kzo9I GATC 1 cut(s) 289
LpnPI CCDG 5 cut(s) 66, 74, 84, 137, 311
MaeI CTAG 1 cut(s) 285
MaeIII GTNAC 2 cut(s) 190, 332
MalI GATC 1 cut(s) 291
MboI GATC 1 cut(s) 289
MboII GAAGA 1 cut(s) 284
MluCI AATT 1 cut(s) 7
MnlI CCTC 4 cut(s) 125, 160, 190, 238
MseI TTAA 2 cut(s) 260, 317
MspI CCGG 1 cut(s) 326
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 1 cut(s) 289
NlaIII CATG 1 cut(s) 15
NmuCI GTSAC 1 cut(s) 190
PstNI CAGNNNCTG 1 cut(s) 32
RsaI GTAC 2 cut(s) 113, 136
RsaNI GTAC 2 cut(s) 112, 135
SaqAI TTAA 2 cut(s) 260, 317
Sau3AI GATC 1 cut(s) 289
SetI ASST 1 cut(s) 117
SgeI CNNG 9 cut(s) 24, 65, 83, 101, 164, 175, 293, 297, 310
Sse9I AATT 1 cut(s) 7
SsiI CCGC 1 cut(s) 242
SspI AATATT 1 cut(s) 186
SspMI CTAG 1 cut(s) 285
StyI CCWWGG 1 cut(s) 162
TaaI ACNGT 1 cut(s) 215
TasI AATT 1 cut(s) 7
Tru1I TTAA 2 cut(s) 260, 317
Tru9I TTAA 2 cut(s) 260, 317
TscAI CASTG 2 cut(s) 33, 99
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 264
TspRI CASTG 2 cut(s) 33, 99
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.