Rh2CG431300

HECT-like Ubiquitin-conjugating enzyme (E2)-binding

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
58653974 .. 58655068
1095 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG431300.1

Sequence Viewer

Length: 213 bp
ATGGCGTCGACAACCAGGAAGTATACCTTGGAGAGAATGTTTGCAAACCAGCTACTCGAATGTGCAAAAGATCAATTATCATTTAGGGCCGTGGTTAGGGACCTGAAACTCAGATCTCCAATGTGTATTCATTTGAGAGGTTTGTGGTCAAATGGTTTGGAGGGTGATCAAGTATTTTCTGAGTTTATGGTTGGTTTTCGTTGTTTTTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.15

Weight (kDa)

8.88

Isoelectric Point (pI)

32.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024971)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0390451
rosa_roxburghii Rroxscaffold_3G00238280
rosa_samantha Rh2CG431300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 8, 23
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 96
AjnI CCWGG 1 cut(s) 14
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AoxI GGCC 1 cut(s) 87
AspS9I GGNCC 2 cut(s) 87, 100
AsuHPI GGTGA 1 cut(s) 176
AvaII GGWCC 1 cut(s) 100
BceAI ACGGC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 16
BclI TGATCA 1 cut(s) 166
BglII AGATCT 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 16
Bme18I GGWCC 1 cut(s) 100
BmgT120I GGNCC 2 cut(s) 87, 100
BmiI GGNNCC 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 16
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 2 cut(s) 27, 90
BsaXI ACNNNNNCTCC 2 cut(s) 23, 53
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 16
BseDI CCNNGG 2 cut(s) 27, 90
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 2 cut(s) 124, 171
BshFI GGCC 1 cut(s) 89
BslFI GGGAC 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 113
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 3 cut(s) 70, 113, 166
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 2 cut(s) 123, 172
BspLI GGNNCC 1 cut(s) 101
BssECI CCNNGG 2 cut(s) 27, 90
BssMI GATC 3 cut(s) 70, 113, 166
BssNAI GTATAC 1 cut(s) 24
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 27
Bst1107I GTATAC 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 16
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 2 cut(s) 110, 180
BstDSI CCRYGG 1 cut(s) 90
BstKTI GATC 3 cut(s) 73, 116, 169
BstMBI GATC 3 cut(s) 70, 113, 166
BstNI CCWGG 1 cut(s) 16
BstSCI CCNGG 1 cut(s) 14
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BstZ17I GTATAC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 89
BtgI CCRYGG 1 cut(s) 90
Cfr13I GGNCC 2 cut(s) 87, 100
CviJI RGCY 2 cut(s) 52, 89
CviKI_1 RGCY 2 cut(s) 52, 89
DdeI CTNAG 2 cut(s) 110, 180
DpnI GATC 3 cut(s) 72, 115, 168
DpnII GATC 3 cut(s) 70, 113, 166
Eco130I CCWWGG 1 cut(s) 27
Eco47I GGWCC 1 cut(s) 100
EcoO109I RGGNCCY 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 14
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaiI YATR 2 cut(s) 24, 188
FalI AAGNNNNNCTT 2 cut(s) 11, 43
FaqI GGGAC 1 cut(s) 113
FbaI TGATCA 1 cut(s) 166
FblI GTMKAC 2 cut(s) 8, 23
HaeIII GGCC 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HphI GGTGA 1 cut(s) 176
Hpy166II GTNNAC 2 cut(s) 9, 24
Hpy188I TCNGA 2 cut(s) 113, 181
Hpy8I GTNNAC 2 cut(s) 9, 24
Hpy99I CGWCG 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 44, 65
HpyF3I CTNAG 2 cut(s) 110, 180
Hsp92I GRCGYC 1 cut(s) 5
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 3 cut(s) 70, 113, 166
LpnPI CCDG 3 cut(s) 28, 62, 116
MalI GATC 3 cut(s) 72, 115, 168
MboI GATC 3 cut(s) 70, 113, 166
MflI RGATCY 1 cut(s) 113
MluCI AATT 1 cut(s) 74
MnlI CCTC 2 cut(s) 131, 154
MspR9I CCNGG 1 cut(s) 16
MvaI CCWGG 1 cut(s) 16
NdeII GATC 3 cut(s) 70, 113, 166
NlaIV GGNNCC 1 cut(s) 101
PpuMI RGGWCCY 1 cut(s) 100
Psp5II RGGWCCY 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 14
PspGI CCWGG 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 101
PspPI GGNCC 2 cut(s) 87, 100
PspPPI RGGWCCY 1 cut(s) 100
PsuI RGATCY 1 cut(s) 113
SalI GTCGAC 1 cut(s) 7
Sau3AI GATC 3 cut(s) 70, 113, 166
Sau96I GGNCC 2 cut(s) 87, 100
ScrFI CCNGG 1 cut(s) 16
SetI ASST 4 cut(s) 29, 54, 105, 142
SgeI CNNG 8 cut(s) 27, 28, 40, 61, 68, 103, 115, 182
SinI GGWCC 1 cut(s) 100
Sse9I AATT 1 cut(s) 74
StyD4I CCNGG 1 cut(s) 14
StyI CCWWGG 1 cut(s) 27
TaqI TCGA 2 cut(s) 8, 57
TasI AATT 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 100
XmiI GTMKAC 2 cut(s) 8, 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.