Rh2CG484000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0021354
Physical Location & Seq
Reverse (-)
64984545 .. 64987434
2890 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG484000.1

Sequence Viewer

Length: 354 bp
ATGTCACTAACTACCAGTTCTGAATGGATACACTGGCTTATGTTCTGTACTACCCTCAGAAGCCGCTTGTCACTACATGAGCCATCGAGCATCTTCACTTCAGGAAACTTCTTGCTAGAATTGTTAGCTTGTTTCCAACACCTATTGCAAGGACATGTTGTTCGTATTATTCTACTGTGTTGCATAAAAAAGATGGGGACCCATGTCAAAGAAGATTTTGGACGTCTAGACAGAGCAAATACGATGGAGCCTTTCAACAATTGCATCATCAACAGATTCATGGAGGATGCAGTGGAATTGGCATATTTGCGATTCATATGGCTAAGTACCAGGGAGCAACTGTATCTGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.78

Weight (kDa)

6.95

Isoelectric Point (pI)

51.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021354)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0110311
rosa_samantha Rh1AG296200 Rh2AG497900 Rh2CG484000 Rh6AG081300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 226
AciI CCGC 1 cut(s) 64
AcuI CTGAAG 1 cut(s) 84
AcyI GRCGYC 1 cut(s) 223
AfaI GTAC 2 cut(s) 49, 328
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 1 cut(s) 256
AjnI CCWGG 1 cut(s) 329
AloI GAACNNNNNNTCC 2 cut(s) 144, 176
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
ArsI GACNNNNNNTTYG 2 cut(s) 144, 176
AspS9I GGNCC 1 cut(s) 198
AvaII GGWCC 1 cut(s) 198
BccI CCATC 3 cut(s) 91, 187, 238
BciT130I CCWGG 1 cut(s) 331
BciVI GTATCC 1 cut(s) 21
BfaI CTAG 2 cut(s) 116, 227
BfuI GTATCC 1 cut(s) 21
BisI GCNGC 1 cut(s) 64
BlsI GCNGC 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 331
Bme18I GGWCC 1 cut(s) 198
BmgT120I GGNCC 1 cut(s) 198
BmiI GGNNCC 3 cut(s) 199, 200, 249
BmrFI CCNGG 1 cut(s) 331
BmsI GCATC 3 cut(s) 99, 273, 277
BoxI GACNNNNGTC 1 cut(s) 203
BsaHI GRCGYC 1 cut(s) 223
BsaJI CCNNGG 1 cut(s) 330
BsaXI ACNNNNNCTCC 1 cut(s) 326
Bse1I ACTGG 2 cut(s) 15, 38
BseBI CCWGG 1 cut(s) 331
BseDI CCNNGG 1 cut(s) 330
BseGI GGATG 1 cut(s) 292
BseMII CTCAG 1 cut(s) 70
BseNI ACTGG 2 cut(s) 15, 38
BslFI GGGAC 1 cut(s) 211
BsmFI GGGAC 1 cut(s) 211
BspACI CCGC 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 69
BspLI GGNNCC 3 cut(s) 199, 200, 249
BsrI ACTGG 2 cut(s) 15, 38
BssECI CCNNGG 1 cut(s) 330
BssNI GRCGYC 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 331
Bst4CI ACNGT 2 cut(s) 177, 342
BstACI GRCGYC 1 cut(s) 223
BstDEI CTNAG 2 cut(s) 56, 323
BstF5I GGATG 1 cut(s) 292
BstNI CCWGG 1 cut(s) 331
BstNSI RCATGY 1 cut(s) 158
BstPAI GACNNNNGTC 1 cut(s) 203
BstSCI CCNGG 1 cut(s) 329
BsuI GTATCC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 292
BtsI GCAGTG 1 cut(s) 297
BtsIMutI CAGTG 2 cut(s) 31, 297
Cfr13I GGNCC 1 cut(s) 198
Csp6I GTAC 2 cut(s) 48, 327
CviAII CATG 4 cut(s) 77, 155, 203, 280
CviJI RGCY 6 cut(s) 37, 63, 82, 128, 250, 322
CviKI_1 RGCY 6 cut(s) 37, 63, 82, 128, 250, 322
CviQI GTAC 2 cut(s) 48, 327
DdeI CTNAG 2 cut(s) 56, 323
Eco47I GGWCC 1 cut(s) 198
Eco57I CTGAAG 1 cut(s) 84
EcoO109I RGGNCCY 1 cut(s) 198
EcoRII CCWGG 1 cut(s) 329
FaeI CATG 4 cut(s) 80, 158, 206, 283
FaiI YATR 9 cut(s) 41, 78, 156, 185, 204, 281, 304, 317, 319
FaqI GGGAC 1 cut(s) 211
FatI CATG 4 cut(s) 76, 154, 202, 279
FauNDI CATATG 1 cut(s) 317
Fnu4HI GCNGC 1 cut(s) 64
FokI GGATG 1 cut(s) 299
Fsp4HI GCNGC 1 cut(s) 64
FspBI CTAG 2 cut(s) 116, 227
GluI GCNGC 1 cut(s) 64
Hin1I GRCGYC 1 cut(s) 223
Hin1II CATG 4 cut(s) 80, 158, 206, 283
HinfI GANTC 2 cut(s) 276, 312
Hpy188I TCNGA 2 cut(s) 22, 59
Hpy188III TCNNGA 2 cut(s) 102, 227
HpyCH4III ACNGT 2 cut(s) 177, 342
HpyCH4IV ACGT 1 cut(s) 223
HpyCH4V TGCA 5 cut(s) 148, 183, 264, 290, 349
HpyF3I CTNAG 2 cut(s) 56, 323
HpySE526I ACGT 1 cut(s) 223
Hsp92I GRCGYC 1 cut(s) 223
Hsp92II CATG 4 cut(s) 80, 158, 206, 283
KflI GGGWCCC 1 cut(s) 198
LmnI GCTCC 2 cut(s) 247, 334
LpnPI CCDG 5 cut(s) 19, 28, 87, 316, 343
LweI GCATC 3 cut(s) 99, 273, 277
MaeI CTAG 2 cut(s) 116, 227
MaeII ACGT 1 cut(s) 223
MaeIII GTNAC 2 cut(s) 3, 69
MboII GAAGA 2 cut(s) 85, 224
MfeI CAATTG 1 cut(s) 259
MluCI AATT 3 cut(s) 119, 259, 296
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 2 cut(s) 65, 277
MspR9I CCNGG 1 cut(s) 331
MunI CAATTG 1 cut(s) 259
MvaI CCWGG 1 cut(s) 331
NdeI CATATG 1 cut(s) 317
NlaIII CATG 4 cut(s) 80, 158, 206, 283
NlaIV GGNNCC 3 cut(s) 199, 200, 249
NmuCI GTSAC 2 cut(s) 3, 69
NspI RCATGY 1 cut(s) 158
PciI ACATGT 1 cut(s) 154
PfeI GAWTC 2 cut(s) 276, 312
PkrI GCNGC 1 cut(s) 65
PpuMI RGGWCCY 1 cut(s) 198
PscI ACATGT 1 cut(s) 154
PshAI GACNNNNGTC 1 cut(s) 203
Psp5II RGGWCCY 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 329
PspGI CCWGG 1 cut(s) 329
PspN4I GGNNCC 3 cut(s) 199, 200, 249
PspPI GGNCC 1 cut(s) 198
PspPPI RGGWCCY 1 cut(s) 198
RsaI GTAC 2 cut(s) 49, 328
RsaNI GTAC 2 cut(s) 48, 327
SatI GCNGC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 198
ScrFI CCNGG 1 cut(s) 331
SetI ASST 3 cut(s) 130, 144, 226
SfaNI GCATC 3 cut(s) 99, 273, 277
SinI GGWCC 1 cut(s) 198
Sse9I AATT 3 cut(s) 119, 259, 296
SsiI CCGC 1 cut(s) 64
SspMI CTAG 2 cut(s) 116, 227
StyD4I CCNGG 1 cut(s) 329
TaaI ACNGT 2 cut(s) 177, 342
TaiI ACGT 1 cut(s) 226
TaqI TCGA 1 cut(s) 86
TasI AATT 3 cut(s) 119, 259, 296
TatI WGTACW 1 cut(s) 47
TauI GCSGC 1 cut(s) 66
TfiI GAWTC 2 cut(s) 276, 312
TscAI CASTG 2 cut(s) 38, 297
TseFI GTSAC 2 cut(s) 3, 69
Tsp45I GTSAC 2 cut(s) 3, 69
TspDTI ATGAA 2 cut(s) 268, 304
TspRI CASTG 2 cut(s) 38, 297
VpaK11BI GGWCC 1 cut(s) 198
XbaI TCTAGA 1 cut(s) 226
XceI RCATGY 1 cut(s) 158
XspI CTAG 2 cut(s) 116, 227
ZraI GACGTC 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.