Rh3BG099600

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0022710
Physical Location & Seq
Forward (+)
7959217 .. 7959894
678 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG099600.1

Sequence Viewer

Length: 366 bp
ATGGACCATGGAGGCAAATTTGCTCGACGAAGGAAAGCACTGACTAAGAAGATGGATACACGAAGATTGGAGGAACTAGACATGGACTGCTTATCGAATATTTTTGGAAGAATTGGAATGGAGTCACTGGTTTTGGCCATCCTTTTGTCTGCAAGTCATGTGATTTTCAAGCATTCCCGAATTATTCAGGAAGTAATTGGAAAGTGGAAATTTTTGGAACAGTTGTGTTTGGGTGGCAACATCAAGAAAATTAGATCACTATTCATATTCTGCGAACATCGCCGCCGCTTGAGTGAACATTTTAAGGCATTGTTGGCTTTGGGGTCATGGGACAAGAGGGAAAATTTGGCTCCAATCCTGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box

Protein Analysis

121

Amino Acids

14.06

Weight (kDa)

10.09

Isoelectric Point (pI)

59.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022710)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0459831
rosa_laevigata RLG00000025057
rosa_samantha Rh3BG099600 Rh3DG101000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 283, 286
AcoI YGGCCR 1 cut(s) 135
AcsI RAATTY 3 cut(s) 17, 209, 343
AgsI TTSAA 1 cut(s) 169
AjnI CCWGG 1 cut(s) 357
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 3 cut(s) 17, 209, 343
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BalI TGGCCA 1 cut(s) 137
BccI CCATC 2 cut(s) 46, 146
BciT130I CCWGG 1 cut(s) 359
BciVI GTATCC 1 cut(s) 49
BfaI CTAG 1 cut(s) 77
BfuI GTATCC 1 cut(s) 49
BisI GCNGC 2 cut(s) 283, 286
BlsI GCNGC 2 cut(s) 284, 287
Bme1390I CCNGG 1 cut(s) 359
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 351
BmrFI CCNGG 1 cut(s) 359
BpuEI CTTGAG 1 cut(s) 310
BsaJI CCNNGG 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 359
BseDI CCNNGG 1 cut(s) 7
BseGI GGATG 1 cut(s) 138
BseNI ACTGG 1 cut(s) 132
BshFI GGCC 1 cut(s) 137
BslFI GGGAC 1 cut(s) 344
BsmFI GGGAC 1 cut(s) 344
BsmI GAATGC 1 cut(s) 172
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 254
Bsp19I CCATGG 1 cut(s) 7
BspACI CCGC 2 cut(s) 283, 286
BspANI GGCC 1 cut(s) 137
BspLI GGNNCC 1 cut(s) 351
BsrI ACTGG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 7
BssMI GATC 1 cut(s) 254
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 359
Bst4CI ACNGT 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 45
BstDSI CCRYGG 1 cut(s) 7
BstF5I GGATG 1 cut(s) 138
BstKTI GATC 1 cut(s) 257
BstMBI GATC 1 cut(s) 254
BstMWI GCNNNNNNNGC 2 cut(s) 279, 314
BstNI CCWGG 1 cut(s) 359
BstSCI CCNGG 1 cut(s) 357
BsuI GTATCC 1 cut(s) 49
BsuRI GGCC 1 cut(s) 137
BtgI CCRYGG 1 cut(s) 7
BtgZI GCGATG 1 cut(s) 263
BtsCI GGATG 1 cut(s) 138
BtsIMutI CAGTG 2 cut(s) 38, 125
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 4 cut(s) 8, 82, 158, 327
CviJI RGCY 3 cut(s) 137, 317, 350
CviKI_1 RGCY 3 cut(s) 137, 317, 350
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 256
DpnII GATC 1 cut(s) 254
EaeI YGGCCR 1 cut(s) 135
Eco130I CCWWGG 1 cut(s) 7
Eco47I GGWCC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 357
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 4 cut(s) 11, 85, 161, 330
FaiI YATR 5 cut(s) 9, 83, 159, 266, 328
FaqI GGGAC 1 cut(s) 344
FatI CATG 4 cut(s) 7, 81, 157, 326
Fnu4HI GCNGC 2 cut(s) 283, 286
FokI GGATG 1 cut(s) 125
Fsp4HI GCNGC 2 cut(s) 283, 286
FspBI CTAG 1 cut(s) 77
GluI GCNGC 2 cut(s) 283, 286
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 4 cut(s) 11, 85, 161, 330
HinfI GANTC 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 296
Hpy188III TCNNGA 3 cut(s) 177, 188, 244
Hpy8I GTNNAC 1 cut(s) 296
Hpy99I CGWCG 1 cut(s) 30
HpyAV CCTTC 1 cut(s) 24
HpyCH4III ACNGT 1 cut(s) 222
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 2 cut(s) 279, 314
HpyF3I CTNAG 1 cut(s) 45
Hsp92II CATG 4 cut(s) 11, 85, 161, 330
Kzo9I GATC 1 cut(s) 254
LmnI GCTCC 1 cut(s) 355
LpnPI CCDG 3 cut(s) 113, 173, 344
MaeI CTAG 1 cut(s) 77
MaeIII GTNAC 1 cut(s) 123
MalI GATC 1 cut(s) 256
MboI GATC 1 cut(s) 254
MboII GAAGA 3 cut(s) 61, 75, 120
MlsI TGGCCA 1 cut(s) 137
MluCI AATT 7 cut(s) 17, 111, 180, 195, 209, 249, 343
MluNI TGGCCA 1 cut(s) 137
MlyI GAGTC 1 cut(s) 131
MnlI CCTC 3 cut(s) 5, 64, 330
Mox20I TGGCCA 1 cut(s) 137
MscI TGGCCA 1 cut(s) 137
MseI TTAA 1 cut(s) 303
Msp20I TGGCCA 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 359
Mva1269I GAATGC 1 cut(s) 172
MvaI CCWGG 1 cut(s) 359
MwoI GCNNNNNNNGC 2 cut(s) 279, 314
NcoI CCATGG 1 cut(s) 7
NdeII GATC 1 cut(s) 254
NlaIII CATG 4 cut(s) 11, 85, 161, 330
NlaIV GGNNCC 1 cut(s) 351
NmuCI GTSAC 1 cut(s) 123
PctI GAATGC 1 cut(s) 172
PkrI GCNGC 2 cut(s) 284, 287
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
Psp6I CCWGG 1 cut(s) 357
PspGI CCWGG 1 cut(s) 357
PspN4I GGNNCC 1 cut(s) 351
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 303
SatI GCNGC 2 cut(s) 283, 286
Sau3AI GATC 1 cut(s) 254
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 359
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 289
SmoI CTYRAG 1 cut(s) 289
Sse9I AATT 7 cut(s) 17, 111, 180, 195, 209, 249, 343
SsiI CCGC 2 cut(s) 283, 286
SspI AATATT 1 cut(s) 100
SspMI CTAG 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 357
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 222
TaqI TCGA 2 cut(s) 25, 95
TasI AATT 7 cut(s) 17, 111, 180, 195, 209, 249, 343
TauI GCSGC 2 cut(s) 285, 288
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TscAI CASTG 2 cut(s) 45, 132
TseFI GTSAC 1 cut(s) 123
Tsp45I GTSAC 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 253
TspRI CASTG 2 cut(s) 45, 132
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 3 cut(s) 17, 209, 343
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.