Rh4AG058700

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
12279623 .. 12291990
12368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG058700.1

Sequence Viewer

Length: 264 bp
ATGTGCATTTGCTTCTTATCTTCACTGAGAAAAGCTCCAGTGCTTCAGAACATAAATGACAGCAGGTTGAATTCAATTTGTATTGTTCAAGAGGGGAAGCCACTTGGGAAGCTGCTTTTTATCACTCAAGGTTCTTTGCATTATAATCTCGTTGTTCGATCTGTGTCATTTGTCTTCCTCTTATCAGAAGCTCTATCTATTGGTTTTGATTCCAAGATCGTTGCATCAATTATTGCTGTGCTTGATCTGGATTGCTGCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.52

Weight (kDa)

7.62

Isoelectric Point (pI)

42.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020680)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 144
Acc36I ACCTGC 1 cut(s) 54
AcsI RAATTY 1 cut(s) 70
AcuI CTGAAG 1 cut(s) 29
AgsI TTSAA 3 cut(s) 70, 75, 89
AluBI AGCT 3 cut(s) 35, 112, 191
AluI AGCT 3 cut(s) 35, 112, 191
ApeKI GCWGC 2 cut(s) 112, 255
ApoI RAATTY 1 cut(s) 70
BbsI GAAGAC 1 cut(s) 166
BbvI GCAGC 2 cut(s) 99, 242
BfuAI ACCTGC 1 cut(s) 54
BisI GCNGC 2 cut(s) 113, 256
BlsI GCNGC 2 cut(s) 114, 257
BmsI GCATC 1 cut(s) 233
BpiI GAAGAC 1 cut(s) 166
BplI GAGNNNNNCTC 2 cut(s) 19, 51
BpmI CTGGAG 1 cut(s) 21
BpuEI CTTGAG 1 cut(s) 111
Bse1I ACTGG 1 cut(s) 38
BseMII CTCAG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 38
BseXI GCAGC 2 cut(s) 99, 242
Bsp143I GATC 3 cut(s) 158, 216, 244
BspCNI CTCAG 1 cut(s) 18
BspMI ACCTGC 1 cut(s) 54
BsrI ACTGG 1 cut(s) 38
BssMI GATC 3 cut(s) 158, 216, 244
BstDEI CTNAG 1 cut(s) 26
BstKTI GATC 3 cut(s) 161, 219, 247
BstMBI GATC 3 cut(s) 158, 216, 244
BstV1I GCAGC 2 cut(s) 99, 242
BstV2I GAAGAC 1 cut(s) 166
BtsIMutI CAGTG 2 cut(s) 23, 45
BveI ACCTGC 1 cut(s) 54
CviJI RGCY 4 cut(s) 35, 100, 112, 191
CviKI_1 RGCY 4 cut(s) 35, 100, 112, 191
DdeI CTNAG 1 cut(s) 26
DpnI GATC 3 cut(s) 160, 218, 246
DpnII GATC 3 cut(s) 158, 216, 244
Eco57I CTGAAG 1 cut(s) 29
EcoRI GAATTC 1 cut(s) 70
FaiI YATR 2 cut(s) 53, 144
Fnu4HI GCNGC 2 cut(s) 113, 256
Fsp4HI GCNGC 2 cut(s) 113, 256
GluI GCNGC 2 cut(s) 113, 256
GsuI CTGGAG 1 cut(s) 21
HinfI GANTC 1 cut(s) 209
Hpy188I TCNGA 2 cut(s) 48, 187
Hpy188III TCNNGA 2 cut(s) 89, 248
HpyCH4V TGCA 4 cut(s) 6, 139, 224, 258
HpyF3I CTNAG 1 cut(s) 26
Kzo9I GATC 3 cut(s) 158, 216, 244
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 49, 51, 233
Lsp1109I GCAGC 2 cut(s) 99, 242
LweI GCATC 1 cut(s) 233
MalI GATC 3 cut(s) 160, 218, 246
MboI GATC 3 cut(s) 158, 216, 244
MboII GAAGA 2 cut(s) 12, 166
MluCI AATT 4 cut(s) 70, 75, 228, 259
MnlI CCTC 2 cut(s) 85, 188
NdeII GATC 3 cut(s) 158, 216, 244
PfeI GAWTC 1 cut(s) 209
PkrI GCNGC 2 cut(s) 114, 257
PsiI TTATAA 1 cut(s) 144
SatI GCNGC 2 cut(s) 113, 256
Sau3AI GATC 3 cut(s) 158, 216, 244
SetI ASST 5 cut(s) 37, 68, 114, 133, 193
SfaNI GCATC 1 cut(s) 233
SgeI CNNG 9 cut(s) 50, 76, 101, 116, 140, 161, 226, 254, 260
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
Sse9I AATT 4 cut(s) 70, 75, 228, 259
TaqI TCGA 1 cut(s) 157
TasI AATT 4 cut(s) 70, 75, 228, 259
TfiI GAWTC 1 cut(s) 209
TscAI CASTG 2 cut(s) 30, 45
TseI GCWGC 2 cut(s) 112, 255
TspRI CASTG 2 cut(s) 30, 45
XapI RAATTY 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.