Rh4AG219300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
51702380 .. 51704147
1768 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG219300.1

Sequence Viewer

Length: 219 bp
ATGGTGGAGGTTGGTCATGAGATCTCTAGAAGTCGAATGCGGAGATCAAGAGATATTGATGATACCAGAGAGGCTCATTCATCGACTCATCGATTTACCAGAGGGGTGGAGATTGGAGTAGTATGTATTGGCTCGGTAGGATTGGAAGATGAGGAAAATGATTGTAAAGCTACCAGAAATGAGGAGGTCCTCGGCCAGTTCAGATCTGCATCCTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.09

Weight (kDa)

5.54

Isoelectric Point (pI)

59.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022720)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0419151
rosa_samantha Rh4AG219300 Rh4BG220700 Rh4DG218100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AcoI YGGCCR 1 cut(s) 193
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AoxI GGCC 1 cut(s) 193
AspS9I GGNCC 1 cut(s) 187
AvaII GGWCC 1 cut(s) 187
BfaI CTAG 1 cut(s) 27
BglII AGATCT 2 cut(s) 21, 203
Bme18I GGWCC 1 cut(s) 187
BmgT120I GGNCC 1 cut(s) 187
Bsa29I ATCGAT 1 cut(s) 91
BsaBI GATNNNNATC 1 cut(s) 208
BsaJI CCNNGG 1 cut(s) 190
Bse1I ACTGG 1 cut(s) 196
Bse8I GATNNNNATC 1 cut(s) 208
BseCI ATCGAT 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 190
BseGI GGATG 1 cut(s) 209
BseJI GATNNNNATC 1 cut(s) 208
BseNI ACTGG 1 cut(s) 196
BseRI GAGGAG 1 cut(s) 197
BshFI GGCC 1 cut(s) 195
BshVI ATCGAT 1 cut(s) 91
BsmI GAATGC 1 cut(s) 42
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 3 cut(s) 21, 44, 203
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 195
BspDI ATCGAT 1 cut(s) 91
BspHI TCATGA 1 cut(s) 16
BsrI ACTGG 1 cut(s) 196
BssECI CCNNGG 1 cut(s) 190
BssMI GATC 3 cut(s) 21, 44, 203
BstF5I GGATG 1 cut(s) 209
BstKTI GATC 3 cut(s) 24, 47, 206
BstMBI GATC 3 cut(s) 21, 44, 203
BstX2I RGATCY 2 cut(s) 21, 203
BstXI CCANNNNNNTGG 1 cut(s) 106
BstYI RGATCY 2 cut(s) 21, 203
Bsu15I ATCGAT 1 cut(s) 91
BsuRI GGCC 1 cut(s) 195
BsuTUI ATCGAT 1 cut(s) 91
BtsCI GGATG 1 cut(s) 209
CciI TCATGA 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 187
ClaI ATCGAT 1 cut(s) 91
CviAII CATG 1 cut(s) 17
CviJI RGCY 4 cut(s) 74, 132, 170, 195
CviKI_1 RGCY 4 cut(s) 74, 132, 170, 195
DpnI GATC 3 cut(s) 23, 46, 205
DpnII GATC 3 cut(s) 21, 44, 203
EaeI YGGCCR 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 187
EcoO109I RGGNCCY 1 cut(s) 187
FaeI CATG 1 cut(s) 20
FaiI YATR 2 cut(s) 18, 124
FatI CATG 1 cut(s) 16
FokI GGATG 1 cut(s) 196
FspBI CTAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 4 cut(s) 17, 27, 48, 216
HpyCH4V TGCA 1 cut(s) 209
Hsp92II CATG 1 cut(s) 20
Kzo9I GATC 3 cut(s) 21, 44, 203
LpnPI CCDG 4 cut(s) 79, 112, 187, 209
MaeI CTAG 1 cut(s) 27
MalI GATC 3 cut(s) 23, 46, 205
MboI GATC 3 cut(s) 21, 44, 203
MboII GAAGA 1 cut(s) 158
MflI RGATCY 2 cut(s) 21, 203
MlyI GAGTC 1 cut(s) 79
MnlI CCTC 6 cut(s) 64, 95, 145, 175, 178, 200
Mva1269I GAATGC 1 cut(s) 42
NdeII GATC 3 cut(s) 21, 44, 203
NlaIII CATG 1 cut(s) 20
NmeAIII GCCGAG 1 cut(s) 171
PagI TCATGA 1 cut(s) 16
PctI GAATGC 1 cut(s) 42
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PpuMI RGGWCCY 1 cut(s) 187
Psp5II RGGWCCY 1 cut(s) 187
PspPI GGNCC 1 cut(s) 187
PspPPI RGGWCCY 1 cut(s) 187
PsuI RGATCY 2 cut(s) 21, 203
Sau3AI GATC 3 cut(s) 21, 44, 203
Sau96I GGNCC 1 cut(s) 187
SchI GAGTC 1 cut(s) 79
SetI ASST 3 cut(s) 12, 172, 189
SgeI CNNG 9 cut(s) 29, 39, 60, 78, 111, 145, 186, 203, 208
SinI GGWCC 1 cut(s) 187
SsiI CCGC 1 cut(s) 40
SspMI CTAG 1 cut(s) 27
TaqI TCGA 3 cut(s) 34, 83, 91
TspDTI ATGAA 1 cut(s) 69
VpaK11BI GGWCC 1 cut(s) 187
XbaI TCTAGA 1 cut(s) 26
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.