Rh4BG415700

Leucine-rich repeats, typical (most populated) subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0026096
Physical Location & Seq
Reverse (-)
56368015 .. 56368332
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG415700.1

Sequence Viewer

Length: 318 bp
ATGGACCAGTATGAAATGGATGGTAAACCTGATTTTTTGAGTGGACATTTCGAGGAGTTATTAACATTGAAAAATTTCGTCTGCCTTGAGGTTTTGCATGAAATTGTAGTGCAAATTGGCCCTCACTGCAAGCGCTTTACGGATTTAACGGTTTATCATACTAGTCTTTGTGAAGTTGAGGCATCGATGATTGTGAAGTTACTGCCAAATCTTAAGAAGTTGTCATTGACTCATTGTCGCATTGATCAGGACAGTGTTGTTAGTTTACTGAGGAGGTACGGTGCAAAGAGCTTGTGCTTTTCAATGCCAGCCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 ubiquitin

Protein Analysis

105

Amino Acids

12.0

Weight (kDa)

6.17

Isoelectric Point (pI)

24.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026096)

Species Orthologous Gene IDs
rosa_samantha Rh4AG404700 Rh4BG415700 Rh4DG410200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 73
AfaI GTAC 1 cut(s) 278
AfeI AGCGCT 1 cut(s) 134
AflII CTTAAG 1 cut(s) 212
AgsI TTSAA 2 cut(s) 70, 303
AhdI GACNNNNNGTC 1 cut(s) 234
AhlI ACTAGT 1 cut(s) 161
AluBI AGCT 1 cut(s) 291
AluI AGCT 1 cut(s) 291
Aor51HI AGCGCT 1 cut(s) 134
AoxI GGCC 1 cut(s) 118
ApoI RAATTY 1 cut(s) 73
Asp700I GAANNNNTTC 1 cut(s) 74
AspLEI GCGC 1 cut(s) 135
AspS9I GGNCC 2 cut(s) 4, 119
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 14
BclI TGATCA 1 cut(s) 244
BcuI ACTAGT 1 cut(s) 161
BfaI CTAG 1 cut(s) 162
BfoI RGCGCY 1 cut(s) 136
BfrI CTTAAG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 4
BmeRI GACNNNNNGTC 1 cut(s) 234
BmgT120I GGNCC 2 cut(s) 4, 119
BmsI GCATC 1 cut(s) 191
BpuEI CTTGAG 1 cut(s) 107
Bsa29I ATCGAT 1 cut(s) 185
BsaXI ACNNNNNCTCC 2 cut(s) 265, 295
Bse1I ACTGG 1 cut(s) 7
BseCI ATCGAT 1 cut(s) 185
BseGI GGATG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 260
BseNI ACTGG 1 cut(s) 7
BseRI GAGGAG 2 cut(s) 68, 286
BshFI GGCC 1 cut(s) 120
BshVI ATCGAT 1 cut(s) 185
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 244
BspANI GGCC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 261
BspDI ATCGAT 1 cut(s) 185
BspTI CTTAAG 1 cut(s) 212
BsrI ACTGG 1 cut(s) 7
BssMI GATC 1 cut(s) 244
Bst4CI ACNGT 3 cut(s) 151, 254, 281
BstAFI CTTAAG 1 cut(s) 212
BstC8I GCNNGC 2 cut(s) 131, 309
BstDEI CTNAG 1 cut(s) 269
BstF5I GGATG 1 cut(s) 25
BstH2I RGCGCY 1 cut(s) 136
BstHHI GCGC 1 cut(s) 135
BstKTI GATC 1 cut(s) 247
BstMBI GATC 1 cut(s) 244
BstMWI GCNNNNNNNGC 1 cut(s) 126
Bsu15I ATCGAT 1 cut(s) 185
BsuRI GGCC 1 cut(s) 120
BsuTUI ATCGAT 1 cut(s) 185
BtsCI GGATG 1 cut(s) 25
BtsI GCAGTG 1 cut(s) 124
BtsIMutI CAGTG 2 cut(s) 124, 259
Cac8I GCNNGC 2 cut(s) 131, 309
CfoI GCGC 1 cut(s) 135
Cfr13I GGNCC 2 cut(s) 4, 119
ClaI ATCGAT 1 cut(s) 185
Csp6I GTAC 1 cut(s) 277
CviAII CATG 1 cut(s) 98
CviJI RGCY 3 cut(s) 120, 291, 311
CviKI_1 RGCY 3 cut(s) 120, 291, 311
CviQI GTAC 1 cut(s) 277
DdeI CTNAG 1 cut(s) 269
DpnI GATC 1 cut(s) 246
DpnII GATC 1 cut(s) 244
DriI GACNNNNNGTC 1 cut(s) 234
Eam1105I GACNNNNNGTC 1 cut(s) 234
Eco47I GGWCC 1 cut(s) 4
Eco47III AGCGCT 1 cut(s) 134
FaeI CATG 1 cut(s) 101
FaiI YATR 3 cut(s) 12, 99, 159
FatI CATG 1 cut(s) 97
FbaI TGATCA 1 cut(s) 244
FokI GGATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 162
GlaI GCGC 1 cut(s) 134
HaeII RGCGCY 1 cut(s) 136
HaeIII GGCC 1 cut(s) 120
HhaI GCGC 1 cut(s) 135
Hin1II CATG 1 cut(s) 101
Hin6I GCGC 1 cut(s) 133
HinP1I GCGC 1 cut(s) 133
HinfI GANTC 1 cut(s) 229
Hpy166II GTNNAC 3 cut(s) 26, 44, 266
Hpy188III TCNNGA 1 cut(s) 248
Hpy8I GTNNAC 3 cut(s) 26, 44, 266
HpyCH4III ACNGT 3 cut(s) 151, 254, 281
HpyCH4V TGCA 4 cut(s) 97, 112, 129, 284
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 269
Hsp92II CATG 1 cut(s) 101
HspAI GCGC 1 cut(s) 133
Ksp22I TGATCA 1 cut(s) 244
Kzo9I GATC 1 cut(s) 244
LpnPI CCDG 3 cut(s) 20, 42, 233
LweI GCATC 1 cut(s) 191
MaeI CTAG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 198
MalI GATC 1 cut(s) 246
MboI GATC 1 cut(s) 244
MfeI CAATTG 1 cut(s) 313
MluCI AATT 4 cut(s) 73, 102, 114, 313
MlyI GAGTC 1 cut(s) 223
MnlI CCTC 6 cut(s) 46, 82, 132, 172, 264, 267
MroXI GAANNNNTTC 1 cut(s) 74
MseI TTAA 3 cut(s) 62, 146, 213
MspCI CTTAAG 1 cut(s) 212
MunI CAATTG 1 cut(s) 313
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 1 cut(s) 244
NlaIII CATG 1 cut(s) 101
PdmI GAANNNNTTC 1 cut(s) 74
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
PspPI GGNCC 2 cut(s) 4, 119
RsaI GTAC 1 cut(s) 278
RsaNI GTAC 1 cut(s) 277
SaqAI TTAA 3 cut(s) 62, 146, 213
Sau3AI GATC 1 cut(s) 244
Sau96I GGNCC 2 cut(s) 4, 119
SchI GAGTC 1 cut(s) 223
SetI ASST 4 cut(s) 31, 93, 278, 293
SfaNI GCATC 1 cut(s) 191
SgeI CNNG 9 cut(s) 19, 41, 64, 98, 110, 142, 174, 260, 304
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 2 cut(s) 86, 212
SmoI CTYRAG 2 cut(s) 86, 212
SpeI ACTAGT 1 cut(s) 161
Sse9I AATT 4 cut(s) 73, 102, 114, 313
SspMI CTAG 1 cut(s) 162
TaaI ACNGT 3 cut(s) 151, 254, 281
TaqI TCGA 2 cut(s) 51, 185
TasI AATT 4 cut(s) 73, 102, 114, 313
Tru1I TTAA 3 cut(s) 62, 146, 213
Tru9I TTAA 3 cut(s) 62, 146, 213
TscAI CASTG 2 cut(s) 131, 259
TspDTI ATGAA 2 cut(s) 27, 114
TspGWI ACGGA 1 cut(s) 155
TspRI CASTG 2 cut(s) 131, 259
Vha464I CTTAAG 1 cut(s) 212
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 73
XmnI GAANNNNTTC 1 cut(s) 74
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.