Rh5AG435400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
74851641 .. 74864339
12699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG435400.1

Sequence Viewer

Length: 186 bp
ATGGATGTGAGAAGTGAGATGCAAAGAGCGGGTTCCAGGCCCAACAGGATTGTTATTCCCAGTGTTCTCAAGGGCATGTGGATAGAAGCTGCCTGGGAACTGAAAAAGTATGTTGATGGAGTATTGTTTACTGACGACTACATGGTGAAAAGGTGTGGGTTGAGCTTGCTTTATGCTCAAGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.05

Weight (kDa)

7.87

Isoelectric Point (pI)

46.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023380)

Species Orthologous Gene IDs
rosa_samantha Rh5AG435400 Rh5CG473800 Rh5DG466400 Rh7DG447200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 29
AciI CCGC 1 cut(s) 29
AjnI CCWGG 2 cut(s) 35, 92
AluBI AGCT 2 cut(s) 89, 165
AluI AGCT 2 cut(s) 89, 165
AoxI GGCC 1 cut(s) 38
ApeKI GCWGC 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 39
AsuHPI GGTGA 1 cut(s) 157
BbvI GCAGC 1 cut(s) 76
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 2 cut(s) 37, 94
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
Bme1390I CCNGG 2 cut(s) 37, 94
BmgT120I GGNCC 1 cut(s) 39
BmiI GGNNCC 1 cut(s) 34
BmrFI CCNGG 2 cut(s) 37, 94
BmrI ACTGGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 9
BmuI ACTGGG 1 cut(s) 54
BpuEI CTTGAG 2 cut(s) 53, 162
BsaJI CCNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 60
BseBI CCWGG 2 cut(s) 37, 94
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 10
BseNI ACTGG 1 cut(s) 60
BseXI GCAGC 1 cut(s) 76
BshFI GGCC 1 cut(s) 40
BsnI GGCC 1 cut(s) 40
BspACI CCGC 1 cut(s) 29
BspANI GGCC 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 34
BsrBI CCGCTC 1 cut(s) 29
BsrI ACTGG 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 93
Bst2UI CCWGG 2 cut(s) 37, 94
BstC8I GCNNGC 1 cut(s) 167
BstF5I GGATG 1 cut(s) 10
BstNI CCWGG 2 cut(s) 37, 94
BstNSI RCATGY 1 cut(s) 79
BstSCI CCNGG 2 cut(s) 35, 92
BstV1I GCAGC 1 cut(s) 76
BsuRI GGCC 1 cut(s) 40
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 167
Cfr13I GGNCC 1 cut(s) 39
CviAII CATG 2 cut(s) 76, 142
CviJI RGCY 3 cut(s) 40, 89, 165
CviKI_1 RGCY 3 cut(s) 40, 89, 165
EcoRII CCWGG 2 cut(s) 35, 92
FaeI CATG 2 cut(s) 79, 145
FaiI YATR 4 cut(s) 77, 111, 143, 174
FatI CATG 2 cut(s) 75, 141
FauI CCCGC 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 90
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 90
GluI GCNGC 1 cut(s) 90
HaeIII GGCC 1 cut(s) 40
Hin1II CATG 2 cut(s) 79, 145
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4V TGCA 1 cut(s) 22
Hsp92II CATG 2 cut(s) 79, 145
LpnPI CCDG 6 cut(s) 22, 31, 49, 73, 79, 106
Lsp1109I GCAGC 1 cut(s) 76
LweI GCATC 1 cut(s) 9
MbiI CCGCTC 1 cut(s) 29
MspR9I CCNGG 2 cut(s) 37, 94
MvaI CCWGG 2 cut(s) 37, 94
NlaIII CATG 2 cut(s) 79, 145
NlaIV GGNNCC 1 cut(s) 34
NspI RCATGY 1 cut(s) 79
PkrI GCNGC 1 cut(s) 91
Psp6I CCWGG 2 cut(s) 35, 92
PspGI CCWGG 2 cut(s) 35, 92
PspN4I GGNNCC 1 cut(s) 34
PspPI GGNCC 1 cut(s) 39
SatI GCNGC 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 39
ScrFI CCNGG 2 cut(s) 37, 94
SetI ASST 3 cut(s) 91, 155, 167
SfaNI GCATC 1 cut(s) 9
SmlI CTYRAG 2 cut(s) 68, 177
SmoI CTYRAG 2 cut(s) 68, 177
SsiI CCGC 1 cut(s) 29
StyD4I CCNGG 2 cut(s) 35, 92
TscAI CASTG 1 cut(s) 67
TseI GCWGC 1 cut(s) 89
TspRI CASTG 1 cut(s) 67
XceI RCATGY 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.