Rh5DG466400

RESISTANCE protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
74079271 .. 74081393
2123 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG466400.1

Sequence Viewer

Length: 207 bp
ATGGACCTCCGTGGCTGCAAAGTATTAGAAGAAATCCCTGATTGCATTAGTAGCTTAACGTCGTTGAATCTGAGTGGAAGTATGATTAAGAGTATACCTTCAACCATCAAACAAGCGTCTAGGCTGAGGTATGTTGATGGAGTATTGTTTACTAACGACTATATGGTGAAAAGGTGTGGGGTGTGCTTGCTTTATGCTCAAGACTAA

Protein Analysis

68

Amino Acids

7.56

Weight (kDa)

7.63

Isoelectric Point (pI)

42.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023380)

Species Orthologous Gene IDs
rosa_samantha Rh5AG435400 Rh5CG473800 Rh5DG466400 Rh7DG447200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 94
AgsI TTSAA 2 cut(s) 67, 102
AluBI AGCT 1 cut(s) 54
AluI AGCT 1 cut(s) 54
ApeKI GCWGC 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 178
AvaII GGWCC 1 cut(s) 4
BbvCI CCTCAGC 1 cut(s) 125
BbvI GCAGC 1 cut(s) 2
BccI CCATC 2 cut(s) 113, 131
BfaI CTAG 1 cut(s) 120
BisI GCNGC 1 cut(s) 16
BlsI GCNGC 1 cut(s) 17
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
Bpu10I CCTNAGC 1 cut(s) 125
BpuEI CTTGAG 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 10
BseMII CTCAG 2 cut(s) 62, 116
BseXI GCAGC 1 cut(s) 2
BspCNI CTCAG 2 cut(s) 63, 117
BssECI CCNNGG 1 cut(s) 10
BssNAI GTATAC 1 cut(s) 95
Bst1107I GTATAC 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 188
BstDEI CTNAG 2 cut(s) 71, 125
BstDSI CCRYGG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 51
BstV1I GCAGC 1 cut(s) 2
BstZ17I GTATAC 1 cut(s) 95
BtgI CCRYGG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 105
CviJI RGCY 3 cut(s) 15, 54, 124
CviKI_1 RGCY 3 cut(s) 15, 54, 124
DdeI CTNAG 2 cut(s) 71, 125
Eco47I GGWCC 1 cut(s) 4
FaiI YATR 6 cut(s) 83, 95, 132, 162, 164, 195
FblI GTMKAC 1 cut(s) 94
Fnu4HI GCNGC 1 cut(s) 16
Fsp4HI GCNGC 1 cut(s) 16
FspBI CTAG 1 cut(s) 120
GluI GCNGC 1 cut(s) 16
HgaI GACGC 1 cut(s) 105
HinfI GANTC 1 cut(s) 67
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 2 cut(s) 95, 150
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 2 cut(s) 95, 150
Hpy99I CGWCG 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 108
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 2 cut(s) 18, 45
HpyF10VI GCNNNNNNNGC 1 cut(s) 51
HpyF3I CTNAG 2 cut(s) 71, 125
HpySE526I ACGT 1 cut(s) 59
LpnPI CCDG 1 cut(s) 51
Lsp1109I GCAGC 1 cut(s) 2
MaeI CTAG 1 cut(s) 120
MaeII ACGT 1 cut(s) 59
MboII GAAGA 1 cut(s) 41
MnlI CCTC 2 cut(s) 17, 120
MseI TTAA 2 cut(s) 56, 87
MwoI GCNNNNNNNGC 1 cut(s) 51
PfeI GAWTC 1 cut(s) 67
PkrI GCNGC 1 cut(s) 17
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 56, 87
SatI GCNGC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 4
SetI ASST 6 cut(s) 9, 56, 62, 100, 131, 176
SgeI CNNG 5 cut(s) 23, 50, 125, 132, 199
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 198
SmoI CTYRAG 1 cut(s) 198
SspMI CTAG 1 cut(s) 120
TaiI ACGT 1 cut(s) 62
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 2 cut(s) 56, 87
Tru9I TTAA 2 cut(s) 56, 87
TseI GCWGC 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 4
XmiI GTMKAC 1 cut(s) 94
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.