Rh5BG207800

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
23966434 .. 23966628
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG207800.1

Sequence Viewer

Length: 195 bp
ATGGAGCAGGATGCGAGGTTCAAAGCCTTTGAGAGACTATCACAAGACAGCCAAACACATGTTTCAACTTTCTCGCAAGATAGTCATGTAAGAGGAACATCAATGGAAGGTCCATGGATTGATTCTTCCGTTTCTCTCGCTAGTAAAAATGAGTCCCATGAACATTCTTCAACAAGCACGCAACTCAAGATGTAA

Protein Analysis

64

Amino Acids

7.2

Weight (kDa)

5.68

Isoelectric Point (pI)

46.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023145)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0033892.1_g000001
rosa_samantha Rh5BG207800 Rh5CG231200 Rh5DG212000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 58
AgsI TTSAA 3 cut(s) 22, 66, 171
AloI GAACNNNNNNTCC 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 110
AvaII GGWCC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 28
BfaI CTAG 1 cut(s) 141
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 113
BseGI GGATG 1 cut(s) 16
BslFI GGGAC 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 28
BsmFI GGGAC 1 cut(s) 139
Bsp19I CCATGG 1 cut(s) 113
BssECI CCNNGG 1 cut(s) 113
BssT1I CCWWGG 1 cut(s) 113
BstC8I GCNNGC 1 cut(s) 179
BstDSI CCRYGG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 16
BstMAI GTCTC 1 cut(s) 28
BstNSI RCATGY 1 cut(s) 62
BtgI CCRYGG 1 cut(s) 113
BtsCI GGATG 1 cut(s) 16
Cac8I GCNNGC 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 110
CviAII CATG 4 cut(s) 59, 86, 114, 158
CviJI RGCY 2 cut(s) 26, 51
CviKI_1 RGCY 2 cut(s) 26, 51
Eco130I CCWWGG 1 cut(s) 113
Eco47I GGWCC 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 4 cut(s) 62, 89, 117, 161
FaiI YATR 4 cut(s) 60, 87, 115, 159
FaqI GGGAC 1 cut(s) 139
FatI CATG 4 cut(s) 58, 85, 113, 157
FokI GGATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 141
Hin1II CATG 4 cut(s) 62, 89, 117, 161
HinfI GANTC 2 cut(s) 122, 152
Hpy188III TCNNGA 1 cut(s) 187
HpyAV CCTTC 1 cut(s) 101
Hsp92II CATG 4 cut(s) 62, 89, 117, 161
LmnI GCTCC 1 cut(s) 4
MaeI CTAG 1 cut(s) 141
MboII GAAGA 2 cut(s) 117, 159
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 2 cut(s) 9, 86
NcoI CCATGG 1 cut(s) 113
NlaIII CATG 4 cut(s) 62, 89, 117, 161
NspI RCATGY 1 cut(s) 62
PciI ACATGT 1 cut(s) 58
PfeI GAWTC 1 cut(s) 122
PleI GAGTC 1 cut(s) 160
PpsI GAGTC 1 cut(s) 160
PscI ACATGT 1 cut(s) 58
PspPI GGNCC 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 110
SchI GAGTC 1 cut(s) 161
SetI ASST 2 cut(s) 20, 112
SinI GGWCC 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
SspMI CTAG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 113
TfiI GAWTC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 174
TspGWI ACGGA 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 110
XceI RCATGY 1 cut(s) 62
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.