Rh5DG212000

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
23788893 .. 23789413
521 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG212000.1

Sequence Viewer

Length: 288 bp
ATGGAGCAGGATGCGAGGTTCAAAGCCTTTGAGAGACTATCACAAGACAGCCAAACACCTGTTTCAACTTTCTCGCAAGATAGTCATGTAAGAGGAACATCAATGGAAGGTCCATGGATTGATTCTTCCGTTTCTCTCGCTAGTAAAAATGAGTCCCATGAACATTCTTCAACAAGCATGCAACTCAAGGATCTGTATGATTATAGGACTAGGTTTTTCAAGCCCGATAAGATTAGATTGGATTTAGATTCCTTGTCCGATAAGGATATACTTTCCTTTGTGGATTAG

Protein Analysis

95

Amino Acids

10.95

Weight (kDa)

5.05

Isoelectric Point (pI)

30.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023145)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0033892.1_g000001
rosa_samantha Rh5BG207800 Rh5CG231200 Rh5DG212000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 198
AgsI TTSAA 4 cut(s) 22, 66, 171, 220
AloI GAACNNNNNNTCC 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 28
AlwI GGATC 1 cut(s) 198
AspS9I GGNCC 1 cut(s) 110
AvaII GGWCC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 28
BfaI CTAG 2 cut(s) 141, 210
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 170
BsaJI CCNNGG 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 113
BseGI GGATG 1 cut(s) 16
BslFI GGGAC 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 28
BsmFI GGGAC 1 cut(s) 139
Bsp143I GATC 1 cut(s) 190
Bsp19I CCATGG 1 cut(s) 113
BspPI GGATC 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 1 cut(s) 190
BssT1I CCWWGG 1 cut(s) 113
BstC8I GCNNGC 1 cut(s) 179
BstDSI CCRYGG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 1 cut(s) 193
BstMAI GTCTC 1 cut(s) 28
BstMBI GATC 1 cut(s) 190
BstNSI RCATGY 1 cut(s) 181
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtgI CCRYGG 1 cut(s) 113
BtsCI GGATG 1 cut(s) 16
Cac8I GCNNGC 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 110
CviAII CATG 4 cut(s) 86, 114, 158, 178
CviJI RGCY 3 cut(s) 26, 51, 223
CviKI_1 RGCY 3 cut(s) 26, 51, 223
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco130I CCWWGG 1 cut(s) 113
Eco47I GGWCC 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 4 cut(s) 89, 117, 161, 181
FaiI YATR 7 cut(s) 87, 115, 159, 179, 198, 204, 269
FaqI GGGAC 1 cut(s) 139
FatI CATG 4 cut(s) 85, 113, 157, 177
FokI GGATG 1 cut(s) 23
FspBI CTAG 2 cut(s) 141, 210
Hin1II CATG 4 cut(s) 89, 117, 161, 181
HinfI GANTC 3 cut(s) 122, 152, 248
Hpy188I TCNGA 1 cut(s) 259
HpyAV CCTTC 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 181
Hsp92II CATG 4 cut(s) 89, 117, 161, 181
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 72
MaeI CTAG 2 cut(s) 141, 210
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 2 cut(s) 117, 159
MflI RGATCY 1 cut(s) 190
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 2 cut(s) 9, 86
NcoI CCATGG 1 cut(s) 113
NdeII GATC 1 cut(s) 190
NlaIII CATG 4 cut(s) 89, 117, 161, 181
NspI RCATGY 1 cut(s) 181
PaeI GCATGC 1 cut(s) 181
PfeI GAWTC 2 cut(s) 122, 248
PleI GAGTC 1 cut(s) 160
PpsI GAGTC 1 cut(s) 160
PspPI GGNCC 1 cut(s) 110
PsuI RGATCY 1 cut(s) 190
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 110
SchI GAGTC 1 cut(s) 161
SetI ASST 4 cut(s) 20, 61, 112, 215
SinI GGWCC 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
SphI GCATGC 1 cut(s) 181
SspMI CTAG 2 cut(s) 141, 210
StyI CCWWGG 1 cut(s) 113
TfiI GAWTC 2 cut(s) 122, 248
TspDTI ATGAA 1 cut(s) 174
TspGWI ACGGA 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 110
XceI RCATGY 1 cut(s) 181
XspI CTAG 2 cut(s) 141, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.