Rh5CG297000

Belongs to the STXBP unc-18 SEC1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0021269
Physical Location & Seq
Reverse (-)
32680063 .. 32680812
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG297000.1

Sequence Viewer

Length: 267 bp
ATGTGGGCCCACCGTCGGAATTCCGAGAATGGGCTTTCAAGGGATGCATCTACTGATTTTGAAAAGATGGGCCGACGCATATTTGTAGTTATAGTAGGTGGAGCTACTAGATCAGAGCTTAGGGTTTGTCGGAAACTCACAGCAAAGCTCAAAAGGGAAGTTATTCTGGGCTCCTCATCTCTTGACGATCCTGCAACTTTTGTTACGAATCTGAAAATGATCACAGCAGACGACCAACCGCTCACGTTGGATGATATCCAGATCTGA

Protein Analysis

88

Amino Acids

9.88

Weight (kDa)

9.03

Isoelectric Point (pI)

47.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sec1 PF00995 6 - 69 1.2e-11 Sec1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021269)

Species Orthologous Gene IDs
pyrus_communis pycom07g10350
rosa_multiflora Rmu_co8350817.1_g000001
rosa_samantha Rh5BG264300 Rh5CG297000 Rh5DG272700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 241
AciI CCGC 1 cut(s) 239
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 19
AfiI CCNNNNNNNGG 2 cut(s) 15, 30
AgsI TTSAA 2 cut(s) 39, 62
AluBI AGCT 3 cut(s) 104, 118, 148
AluI AGCT 3 cut(s) 104, 118, 148
AlwI GGATC 1 cut(s) 182
AoxI GGCC 2 cut(s) 6, 70
ApaI GGGCCC 1 cut(s) 10
ApoI RAATTY 1 cut(s) 19
Asp700I GAANNNNTTC 1 cut(s) 162
AspS9I GGNCC 3 cut(s) 6, 7, 70
BaeGI GKGCMC 1 cut(s) 10
BanII GRGCYC 2 cut(s) 10, 173
BccI CCATC 1 cut(s) 61
BclI TGATCA 1 cut(s) 219
BfaI CTAG 1 cut(s) 108
BglII AGATCT 1 cut(s) 261
BmgT120I GGNCC 3 cut(s) 6, 7, 70
BmiI GGNNCC 2 cut(s) 8, 172
BmsI GCATC 2 cut(s) 34, 56
Bpu10I CCTNAGC 1 cut(s) 119
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 30
BseGI GGATG 2 cut(s) 49, 256
BseLI CCNNNNNNNGG 2 cut(s) 15, 30
BseRI GAGGAG 1 cut(s) 163
BseSI GKGCMC 1 cut(s) 10
BshFI GGCC 2 cut(s) 8, 72
BslI CCNNNNNNNGG 2 cut(s) 15, 30
BsnI GGCC 2 cut(s) 8, 72
Bsp120I GGGCCC 1 cut(s) 6
Bsp1286I GDGCHC 2 cut(s) 10, 173
Bsp143I GATC 4 cut(s) 110, 187, 219, 261
BspACI CCGC 1 cut(s) 239
BspANI GGCC 2 cut(s) 8, 72
BspLI GGNNCC 2 cut(s) 8, 172
BspPI GGATC 1 cut(s) 182
BsrBI CCGCTC 1 cut(s) 241
BssMI GATC 4 cut(s) 110, 187, 219, 261
Bst4CI ACNGT 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 119
BstF5I GGATG 2 cut(s) 49, 256
BstKTI GATC 4 cut(s) 113, 190, 222, 264
BstMBI GATC 4 cut(s) 110, 187, 219, 261
BstSLI GKGCMC 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 261
BstYI RGATCY 1 cut(s) 261
BsuRI GGCC 2 cut(s) 8, 72
BtsCI GGATG 2 cut(s) 49, 256
Cfr13I GGNCC 3 cut(s) 6, 7, 70
CseI GACGC 1 cut(s) 84
CviJI RGCY 7 cut(s) 8, 34, 72, 104, 118, 148, 171
CviKI_1 RGCY 7 cut(s) 8, 34, 72, 104, 118, 148, 171
DdeI CTNAG 1 cut(s) 119
DpnI GATC 4 cut(s) 112, 189, 221, 263
DpnII GATC 4 cut(s) 110, 187, 219, 261
Eco24I GRGCYC 2 cut(s) 10, 173
Eco32I GATATC 1 cut(s) 256
EcoRI GAATTC 1 cut(s) 19
EcoRV GATATC 1 cut(s) 256
EcoT22I ATGCAT 1 cut(s) 49
EcoT38I GRGCYC 2 cut(s) 10, 173
FaiI YATR 2 cut(s) 80, 92
FbaI TGATCA 1 cut(s) 219
FokI GGATG 2 cut(s) 56, 263
FriOI GRGCYC 2 cut(s) 10, 173
FspBI CTAG 1 cut(s) 108
HaeIII GGCC 2 cut(s) 8, 72
HgaI GACGC 1 cut(s) 84
HinfI GANTC 1 cut(s) 208
Hpy188I TCNGA 6 cut(s) 18, 25, 115, 132, 213, 266
Hpy188III TCNNGA 2 cut(s) 182, 259
Hpy99I CGWCG 2 cut(s) 18, 78
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4IV ACGT 1 cut(s) 245
HpyCH4V TGCA 2 cut(s) 47, 194
HpyF3I CTNAG 1 cut(s) 119
HpySE526I ACGT 1 cut(s) 245
Ksp22I TGATCA 1 cut(s) 219
Kzo9I GATC 4 cut(s) 110, 187, 219, 261
LmnI GCTCC 2 cut(s) 101, 176
LpnPI CCDG 2 cut(s) 152, 204
LweI GCATC 2 cut(s) 34, 56
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 245
MaeIII GTNAC 1 cut(s) 202
MalI GATC 4 cut(s) 112, 189, 221, 263
MbiI CCGCTC 1 cut(s) 241
MboI GATC 4 cut(s) 110, 187, 219, 261
MflI RGATCY 1 cut(s) 261
MhlI GDGCHC 2 cut(s) 10, 173
MluCI AATT 1 cut(s) 19
MmeI TCCRAC 2 cut(s) 110, 228
MnlI CCTC 1 cut(s) 184
Mph1103I ATGCAT 1 cut(s) 49
MroXI GAANNNNTTC 1 cut(s) 162
NdeII GATC 4 cut(s) 110, 187, 219, 261
NlaIV GGNNCC 2 cut(s) 8, 172
NsiI ATGCAT 1 cut(s) 49
PdmI GAANNNNTTC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 208
PspN4I GGNNCC 2 cut(s) 8, 172
PspOMI GGGCCC 1 cut(s) 6
PspPI GGNCC 3 cut(s) 6, 7, 70
PsuI RGATCY 1 cut(s) 261
Sau3AI GATC 4 cut(s) 110, 187, 219, 261
Sau96I GGNCC 3 cut(s) 6, 7, 70
SduI GDGCHC 2 cut(s) 10, 173
SetI ASST 5 cut(s) 100, 106, 120, 150, 248
SfaNI GCATC 2 cut(s) 34, 56
SgeI CNNG 7 cut(s) 37, 51, 120, 179, 194, 203, 256
Sse9I AATT 1 cut(s) 19
SsiI CCGC 1 cut(s) 239
SspMI CTAG 1 cut(s) 108
TaaI ACNGT 1 cut(s) 14
TaiI ACGT 1 cut(s) 248
TasI AATT 1 cut(s) 19
TfiI GAWTC 1 cut(s) 208
XapI RAATTY 1 cut(s) 19
XmnI GAANNNNTTC 1 cut(s) 162
XspI CTAG 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.