Rh5DG180400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
19952175 .. 19953011
837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG180400.1

Sequence Viewer

Length: 291 bp
ATGGTTGCATTATCTTCTGGACATCTAGTCATTAAAATTCTCAGTGTCCATATTCAGCTAGCAAATCTACAGAGCAAGATCAGATATACTATATTCATGTCAGGAAGCTCCGTCGTCTCATCATCAGTATGGGGGTTATTCTTGTTCATCTTTGGGCTGTGTGTTCTGGTAGAAGCTCAAGCTCCTTCTTCTCAACCTTCTCAAGCTCCTAGTTCTCAACCTCAAGCTACCACTGATCCATTTGAAGTTTTTCGATATTCAATTTTGGAGAAAGATACATTGATACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.47

Weight (kDa)

6.7

Isoelectric Point (pI)

60.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026632)

Species Orthologous Gene IDs
rosa_samantha Rh5CG198000 Rh5DG180400
rosa_wichuraiana Rw5G016500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 230
AcsI RAATTY 1 cut(s) 36
AgsI TTSAA 2 cut(s) 245, 261
AhdI GACNNNNNGTC 1 cut(s) 26
AluBI AGCT 6 cut(s) 58, 108, 176, 182, 206, 227
AluI AGCT 6 cut(s) 58, 108, 176, 182, 206, 227
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 1 cut(s) 230
ApoI RAATTY 1 cut(s) 36
Asp700I GAANNNNTTC 1 cut(s) 249
AsuNHI GCTAGC 1 cut(s) 58
BcoDI GTCTC 1 cut(s) 121
BfaI CTAG 3 cut(s) 26, 59, 210
BfmI CTRYAG 1 cut(s) 68
BmeRI GACNNNNNGTC 1 cut(s) 26
BmtI GCTAGC 1 cut(s) 62
BpuEI CTTGAG 3 cut(s) 162, 186, 207
BseMII CTCAG 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 121
BsmBI CGTCTC 1 cut(s) 121
Bsp143I GATC 2 cut(s) 78, 235
BspCNI CTCAG 1 cut(s) 54
BspOI GCTAGC 1 cut(s) 62
BspPI GGATC 1 cut(s) 230
BssMI GATC 2 cut(s) 78, 235
BstC8I GCNNGC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 2 cut(s) 81, 238
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 2 cut(s) 78, 235
BstSFI CTRYAG 1 cut(s) 68
BtsIMutI CAGTG 2 cut(s) 49, 231
Cac8I GCNNGC 1 cut(s) 60
CviAII CATG 1 cut(s) 97
CviJI RGCY 7 cut(s) 58, 108, 157, 176, 182, 206, 227
CviKI_1 RGCY 7 cut(s) 58, 108, 157, 176, 182, 206, 227
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 80, 237
DpnII GATC 2 cut(s) 78, 235
DriI GACNNNNNGTC 1 cut(s) 26
Eam1105I GACNNNNNGTC 1 cut(s) 26
Esp3I CGTCTC 1 cut(s) 121
FaeI CATG 1 cut(s) 100
FaiI YATR 5 cut(s) 51, 87, 92, 98, 130
FatI CATG 1 cut(s) 96
FspBI CTAG 3 cut(s) 26, 59, 210
Hin1II CATG 1 cut(s) 100
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 18, 102
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 2 cut(s) 195, 207
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 41
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 2 cut(s) 78, 235
LmnI GCTCC 3 cut(s) 113, 187, 211
LpnPI CCDG 3 cut(s) 3, 87, 152
MaeI CTAG 3 cut(s) 26, 59, 210
MalI GATC 2 cut(s) 80, 237
MboI GATC 2 cut(s) 78, 235
MboII GAAGA 2 cut(s) 6, 180
MluCI AATT 2 cut(s) 36, 261
MnlI CCTC 1 cut(s) 231
MroXI GAANNNNTTC 1 cut(s) 249
MseI TTAA 1 cut(s) 33
MslI CAYNNNNRTG 1 cut(s) 127
NdeII GATC 2 cut(s) 78, 235
NheI GCTAGC 1 cut(s) 58
NlaIII CATG 1 cut(s) 100
PdmI GAANNNNTTC 1 cut(s) 249
RseI CAYNNNNRTG 1 cut(s) 127
SaqAI TTAA 1 cut(s) 33
Sau3AI GATC 2 cut(s) 78, 235
SetI ASST 8 cut(s) 60, 110, 178, 184, 199, 208, 223, 229
SfcI CTRYAG 1 cut(s) 68
SmiMI CAYNNNNRTG 1 cut(s) 127
SmlI CTYRAG 3 cut(s) 177, 201, 222
SmoI CTYRAG 3 cut(s) 177, 201, 222
Sse9I AATT 2 cut(s) 36, 261
SspMI CTAG 3 cut(s) 26, 59, 210
TaqI TCGA 1 cut(s) 253
TasI AATT 2 cut(s) 36, 261
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TscAI CASTG 2 cut(s) 49, 238
TspDTI ATGAA 2 cut(s) 85, 136
TspGWI ACGGA 1 cut(s) 100
TspRI CASTG 2 cut(s) 49, 238
XapI RAATTY 1 cut(s) 36
XmnI GAANNNNTTC 1 cut(s) 249
XspI CTAG 3 cut(s) 26, 59, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.