Rh5DG215300

EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
24336892 .. 24337501
610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG215300.1

Sequence Viewer

Length: 243 bp
ATGCCTTCTGTCTTAGCCTCCCTGGGTGCTAAAGCTCAAGTCTTTGACAACGAAATCATGGTTAACATTGATGGGATTACATCGGTTGAGCCTATTTCTGATGAGATTCGGAAGATTCGAGGTGGGTTTTTTGTCCTCGATGATGCTGTGGTTGCATCACCCGGTGGCTGTGATATTGGGCTTCCAGACCGGTGGACCTTTACATTTGGGGTCTTCAAGCTCTTGGTGCTGTTGTGGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.66

Weight (kDa)

4.38

Isoelectric Point (pI)

46.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019936)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0030641
rosa_multiflora Rmu_co8427705.1_g000001
rosa_roxburghii Rroxscaffold_2G00123230
rosa_rugosa Rorug05G0119000
rosa_samantha Rh5BG210300 Rh5CG234000 Rh5DG215300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 164
AgeI ACCGGT 1 cut(s) 189
AgsI TTSAA 1 cut(s) 217
AjnI CCWGG 1 cut(s) 21
AluBI AGCT 2 cut(s) 35, 220
AluI AGCT 2 cut(s) 35, 220
AsiGI ACCGGT 1 cut(s) 189
AspS9I GGNCC 1 cut(s) 195
AsuC2I CCSGG 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 150
AvaII GGWCC 1 cut(s) 195
BbsI GAAGAC 1 cut(s) 205
BccI CCATC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 23
BcnI CCSGG 1 cut(s) 162
Bme1390I CCNGG 2 cut(s) 23, 162
Bme18I GGWCC 1 cut(s) 195
BmgT120I GGNCC 1 cut(s) 195
BmrFI CCNGG 2 cut(s) 23, 162
BmsI GCATC 2 cut(s) 133, 164
BpiI GAAGAC 1 cut(s) 205
BpuEI CTTGAG 1 cut(s) 21
BpuMI CCSGG 1 cut(s) 162
BsaJI CCNNGG 2 cut(s) 21, 22
BsaWI WCCGGW 1 cut(s) 189
Bse118I RCCGGY 1 cut(s) 189
BseBI CCWGG 1 cut(s) 23
BseDI CCNNGG 2 cut(s) 21, 22
BshTI ACCGGT 1 cut(s) 189
BsiSI CCGG 2 cut(s) 162, 190
BsrFI RCCGGY 1 cut(s) 189
BssAI RCCGGY 1 cut(s) 189
BssECI CCNNGG 2 cut(s) 21, 22
Bst2UI CCWGG 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 13
BstMWI GCNNNNNNNGC 2 cut(s) 152, 226
BstNI CCWGG 1 cut(s) 23
BstSCI CCNGG 2 cut(s) 21, 160
BstV2I GAAGAC 1 cut(s) 205
BstXI CCANNNNNNTGG 1 cut(s) 192
Cfr10I RCCGGY 1 cut(s) 189
Cfr13I GGNCC 1 cut(s) 195
CspAI ACCGGT 1 cut(s) 189
CviAII CATG 1 cut(s) 58
CviJI RGCY 6 cut(s) 17, 35, 91, 168, 181, 220
CviKI_1 RGCY 6 cut(s) 17, 35, 91, 168, 181, 220
DdeI CTNAG 1 cut(s) 13
DraIII CACNNNGTG 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 195
EcoRII CCWGG 1 cut(s) 21
FaeI CATG 1 cut(s) 61
FaiI YATR 1 cut(s) 59
FatI CATG 1 cut(s) 57
HapII CCGG 2 cut(s) 162, 190
Hin1II CATG 1 cut(s) 61
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
HinfI GANTC 2 cut(s) 106, 115
HpaI GTTAAC 1 cut(s) 64
HpaII CCGG 2 cut(s) 162, 190
HphI GGTGA 1 cut(s) 150
Hpy166II GTNNAC 2 cut(s) 64, 195
Hpy188I TCNGA 2 cut(s) 100, 111
Hpy188III TCNNGA 1 cut(s) 185
Hpy8I GTNNAC 2 cut(s) 64, 195
HpyAV CCTTC 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 2 cut(s) 152, 226
HpyF3I CTNAG 1 cut(s) 13
Hsp92II CATG 1 cut(s) 61
KspAI GTTAAC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 8, 35, 175, 198, 203
LweI GCATC 2 cut(s) 133, 164
MboII GAAGA 2 cut(s) 124, 205
MnlI CCTC 3 cut(s) 28, 113, 146
MseI TTAA 1 cut(s) 63
MspI CCGG 2 cut(s) 162, 190
MspR9I CCNGG 2 cut(s) 23, 162
MvaI CCWGG 1 cut(s) 23
MwoI GCNNNNNNNGC 2 cut(s) 152, 226
NciI CCSGG 1 cut(s) 162
NlaIII CATG 1 cut(s) 61
PasI CCCWGGG 1 cut(s) 22
PcsI WCGNNNNNNNCGW 1 cut(s) 115
PfeI GAWTC 2 cut(s) 106, 115
PinAI ACCGGT 1 cut(s) 189
Psp6I CCWGG 1 cut(s) 21
PspGI CCWGG 1 cut(s) 21
PspPI GGNCC 1 cut(s) 195
SaqAI TTAA 1 cut(s) 63
Sau96I GGNCC 1 cut(s) 195
ScrFI CCNGG 2 cut(s) 23, 162
SetI ASST 4 cut(s) 37, 124, 200, 222
SfaNI GCATC 2 cut(s) 133, 164
SinI GGWCC 1 cut(s) 195
SmlI CTYRAG 1 cut(s) 36
SmoI CTYRAG 1 cut(s) 36
StyD4I CCNGG 2 cut(s) 21, 160
TaqI TCGA 2 cut(s) 118, 138
TfiI GAWTC 2 cut(s) 106, 115
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.