Rh6AG075900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
10764555 .. 10765038
484 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG075900.1

Sequence Viewer

Length: 273 bp
ATGCTAATGTTAGAACCAACTCTGCTTCAAGGGTTCTTCAAATCGCTTCCCTTTCCCATCCCATCGCTTCAGGGTTATTCCCTTCCCATTGTTGTAGGGTTCTTCAAATCTCTTGGCGGTGGTGATTGTTGCTTTATTTGGTTGCTTGTGGCTTCGATTGGCTTCGGCGGTGGTGTTGGCTTCGATTCGGCAGTGGCTGTAGCTTTGGAGGCTGAGCATATGTACCTTTCCTTCAACAACGACGAGGCCAGATCCCCATTCATTCTTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.62

Weight (kDa)

4.43

Isoelectric Point (pI)

48.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021356)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0169481 RchiOBHm_Chr2g0174901
rosa_laevigata RLG00000008426
rosa_samantha Rh2CG409800 Rh6AG075900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 117, 168
AclWI GGATC 1 cut(s) 246
AcuI CTGAAG 1 cut(s) 53
AfaI GTAC 1 cut(s) 224
AgsI TTSAA 4 cut(s) 29, 40, 106, 235
AluBI AGCT 1 cut(s) 203
AluI AGCT 1 cut(s) 203
AlwI GGATC 1 cut(s) 246
AlwNI CAGNNNCTG 1 cut(s) 197
AoxI GGCC 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 134
BarI GAAGNNNNNNTAC 2 cut(s) 215, 247
BccI CCATC 2 cut(s) 65, 70
BfmI CTRYAG 1 cut(s) 198
BlpI GCTNAGC 1 cut(s) 213
Bpu1102I GCTNAGC 1 cut(s) 213
BseGI GGATG 1 cut(s) 57
BseMII CTCAG 1 cut(s) 204
BshFI GGCC 1 cut(s) 248
BsnI GGCC 1 cut(s) 248
Bsp143I GATC 1 cut(s) 251
Bsp1720I GCTNAGC 1 cut(s) 213
BspACI CCGC 2 cut(s) 117, 168
BspANI GGCC 1 cut(s) 248
BspCNI CTCAG 1 cut(s) 205
BspPI GGATC 1 cut(s) 246
BssMI GATC 1 cut(s) 251
BstDEI CTNAG 1 cut(s) 213
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 1 cut(s) 254
BstMBI GATC 1 cut(s) 251
BstMWI GCNNNNNNNGC 1 cut(s) 209
BstSFI CTRYAG 1 cut(s) 198
BstX2I RGATCY 1 cut(s) 251
BstYI RGATCY 1 cut(s) 251
BsuRI GGCC 1 cut(s) 248
BtgZI GCGATG 1 cut(s) 48
BtsCI GGATG 1 cut(s) 57
BtsI GCAGTG 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 198
CaiI CAGNNNCTG 1 cut(s) 197
Csp6I GTAC 1 cut(s) 223
CviJI RGCY 8 cut(s) 152, 162, 180, 197, 203, 212, 248, 270
CviKI_1 RGCY 8 cut(s) 152, 162, 180, 197, 203, 212, 248, 270
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 1 cut(s) 213
DpnI GATC 1 cut(s) 253
DpnII GATC 1 cut(s) 251
Eco57I CTGAAG 1 cut(s) 53
FaiI YATR 2 cut(s) 219, 221
FauNDI CATATG 1 cut(s) 219
FokI GGATG 1 cut(s) 44
HaeIII GGCC 1 cut(s) 248
HinfI GANTC 1 cut(s) 185
HphI GGTGA 1 cut(s) 134
Hpy99I CGWCG 1 cut(s) 245
HpyAV CCTTC 2 cut(s) 92, 241
HpyF10VI GCNNNNNNNGC 1 cut(s) 209
HpyF3I CTNAG 1 cut(s) 213
Kzo9I GATC 1 cut(s) 251
LpnPI CCDG 2 cut(s) 56, 262
MalI GATC 1 cut(s) 253
MboI GATC 1 cut(s) 251
MboII GAAGA 2 cut(s) 28, 94
MflI RGATCY 1 cut(s) 251
MnlI CCTC 2 cut(s) 202, 238
MwoI GCNNNNNNNGC 1 cut(s) 209
NdeI CATATG 1 cut(s) 219
NdeII GATC 1 cut(s) 251
PfeI GAWTC 1 cut(s) 185
PstNI CAGNNNCTG 1 cut(s) 197
PsuI RGATCY 1 cut(s) 251
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
Sau3AI GATC 1 cut(s) 251
SetI ASST 2 cut(s) 205, 228
SfcI CTRYAG 1 cut(s) 198
SgeI CNNG 6 cut(s) 41, 83, 125, 158, 256, 261
SsiI CCGC 2 cut(s) 117, 168
TaqI TCGA 2 cut(s) 155, 183
TfiI GAWTC 1 cut(s) 185
TscAI CASTG 1 cut(s) 198
TspDTI ATGAA 1 cut(s) 250
TspRI CASTG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.