Rh6BG066000

Subtilisin-like serine endopeptidase family protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0025605
Physical Location & Seq
Forward (+)
10278029 .. 10293423
15395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG066000.1

Sequence Viewer

Length: 501 bp
ATGGATTACGATTACCCTTCACTAGCTACTGTTGTTTCATCAAAGCAAGCATTTACTATTAAATTTCACAGAACAGTTAAGAACGTTGGCCTTGCAAACTCCACCTACAAGGCCAGAATTTTCACAAACTCCACTCGAGTCGACATCAAGGTTCTGCCTGAAGTTCTTTCTTTCAAGTCTTTGAATGAGGAGAAGCCTTTTGATGTGACCGTTGTTGGAGGAGGATTGTCAGATGGCGCACAACTGGCATGTGTCGGCACTGCTGGTTTGGATACTCAGAGTCTTACATCATTGTCATCGTGCATCAAACGAAACCAAACATATCTCAATCACTCAACAAGCACTACTGTAGTACCGTACAAGAGTTTTGGTTTGTGGAGAGCACTAGCGCTGAACAAGACGTGCCTGTTATTTGCGTATCACTTGGAGGCTAATCTGCTCTATCCTCTATTCTCTATCATCTATCTTCCACACGTCATAAAAAATTCAAGGTTTTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005576
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 PA Peptidase_S8

Protein Analysis

166

Amino Acids

18.39

Weight (kDa)

9.32

Isoelectric Point (pI)

32.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 4 - 73 7.3e-14 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025605)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0006170.1_g000005
rosa_roxburghii Rroxscaffold_7G00210270
rosa_samantha Rh6BG066000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 141
AclI AACGTT 1 cut(s) 84
AcsI RAATTY 3 cut(s) 62, 117, 484
AcuI CTGAAG 1 cut(s) 180
AfaI GTAC 2 cut(s) 354, 359
AfeI AGCGCT 1 cut(s) 390
AflIII ACRYGT 1 cut(s) 472
AgsI TTSAA 3 cut(s) 175, 184, 489
AjiI CACGTC 2 cut(s) 402, 475
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
Alw21I GWGCWC 1 cut(s) 385
Ama87I CYCGRG 1 cut(s) 135
Aor51HI AGCGCT 1 cut(s) 390
AoxI GGCC 2 cut(s) 88, 111
ApoI RAATTY 3 cut(s) 62, 117, 484
AspLEI GCGC 2 cut(s) 239, 391
AvaI CYCGRG 1 cut(s) 135
BaeI ACNNNNGTAYC 2 cut(s) 336, 369
Bbv12I GWGCWC 1 cut(s) 385
BccI CCATC 1 cut(s) 227
BciVI GTATCC 1 cut(s) 265
BfaI CTAG 2 cut(s) 23, 386
BfmI CTRYAG 1 cut(s) 348
BfoI RGCGCY 1 cut(s) 392
BfuI GTATCC 1 cut(s) 265
BmeT110I CYCGRG 1 cut(s) 135
BmgBI CACGTC 2 cut(s) 402, 475
BmsI GCATC 1 cut(s) 312
Bse1I ACTGG 1 cut(s) 249
BseMII CTCAG 1 cut(s) 290
BseNI ACTGG 1 cut(s) 249
BseRI GAGGAG 2 cut(s) 203, 234
BshFI GGCC 2 cut(s) 90, 113
BsiHKAI GWGCWC 1 cut(s) 385
BsiHKCI CYCGRG 1 cut(s) 135
BsnI GGCC 2 cut(s) 90, 113
BsoBI CYCGRG 1 cut(s) 135
Bsp1286I GDGCHC 1 cut(s) 385
BspANI GGCC 2 cut(s) 90, 113
BspCNI CTCAG 1 cut(s) 289
BsrI ACTGG 1 cut(s) 249
Bst4CI ACNGT 5 cut(s) 31, 76, 211, 349, 357
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 276
BstH2I RGCGCY 1 cut(s) 392
BstHHI GCGC 2 cut(s) 239, 391
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstNSI RCATGY 1 cut(s) 252
BstSFI CTRYAG 1 cut(s) 348
BsuI GTATCC 1 cut(s) 265
BsuRI GGCC 2 cut(s) 90, 113
BtrI CACGTC 2 cut(s) 402, 475
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
Cac8I GCNNGC 1 cut(s) 48
CfoI GCGC 2 cut(s) 239, 391
Csp6I GTAC 2 cut(s) 353, 358
CviAII CATG 1 cut(s) 249
CviJI RGCY 5 cut(s) 26, 90, 113, 196, 431
CviKI_1 RGCY 5 cut(s) 26, 90, 113, 196, 431
CviQI GTAC 2 cut(s) 353, 358
DdeI CTNAG 1 cut(s) 276
Eco47III AGCGCT 1 cut(s) 390
Eco57I CTGAAG 1 cut(s) 180
Eco88I CYCGRG 1 cut(s) 135
FaeI CATG 1 cut(s) 252
FaiI YATR 3 cut(s) 250, 322, 479
FatI CATG 1 cut(s) 248
FblI GTMKAC 1 cut(s) 141
FspBI CTAG 2 cut(s) 23, 386
GlaI GCGC 2 cut(s) 238, 390
HaeII RGCGCY 1 cut(s) 392
HaeIII GGCC 2 cut(s) 90, 113
HhaI GCGC 2 cut(s) 239, 391
Hin1II CATG 1 cut(s) 252
Hin6I GCGC 2 cut(s) 237, 389
HinP1I GCGC 2 cut(s) 237, 389
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 2 cut(s) 138, 280
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 232, 279
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 27
HpyCH4III ACNGT 5 cut(s) 31, 76, 211, 349, 357
HpyCH4IV ACGT 3 cut(s) 84, 401, 474
HpyCH4V TGCA 2 cut(s) 95, 303
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpyF3I CTNAG 1 cut(s) 276
HpySE526I ACGT 3 cut(s) 84, 401, 474
Hsp92II CATG 1 cut(s) 252
HspAI GCGC 2 cut(s) 237, 389
LpnPI CCDG 5 cut(s) 127, 171, 230, 249, 419
LweI GCATC 1 cut(s) 312
MaeI CTAG 2 cut(s) 23, 386
MaeII ACGT 3 cut(s) 84, 401, 474
MaeIII GTNAC 1 cut(s) 205
MboII GAAGA 1 cut(s) 458
MhlI GDGCHC 1 cut(s) 385
MluCI AATT 3 cut(s) 62, 117, 484
MlyI GAGTC 2 cut(s) 147, 289
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 5 cut(s) 181, 212, 215, 421, 456
MseI TTAA 3 cut(s) 60, 78, 499
MwoI GCNNNNNNNGC 1 cut(s) 245
NlaIII CATG 1 cut(s) 252
NmuCI GTSAC 1 cut(s) 205
NspI RCATGY 1 cut(s) 252
PaeR7I CTCGAG 1 cut(s) 135
PleI GAGTC 2 cut(s) 146, 288
PpsI GAGTC 2 cut(s) 146, 288
Psp1406I AACGTT 1 cut(s) 84
PspXI VCTCGAGB 1 cut(s) 135
RsaI GTAC 2 cut(s) 354, 359
RsaNI GTAC 2 cut(s) 353, 358
SalI GTCGAC 1 cut(s) 140
SaqAI TTAA 3 cut(s) 60, 78, 499
SchI GAGTC 2 cut(s) 147, 289
SduI GDGCHC 1 cut(s) 385
SetI ASST 7 cut(s) 28, 87, 107, 153, 404, 477, 494
SfaNI GCATC 1 cut(s) 312
SfcI CTRYAG 1 cut(s) 348
Sfr274I CTCGAG 1 cut(s) 135
SlaI CTCGAG 1 cut(s) 135
SmlI CTYRAG 1 cut(s) 135
SmoI CTYRAG 1 cut(s) 135
Sse9I AATT 3 cut(s) 62, 117, 484
SspMI CTAG 2 cut(s) 23, 386
TaaI ACNGT 5 cut(s) 31, 76, 211, 349, 357
TaiI ACGT 3 cut(s) 87, 404, 477
TaqI TCGA 2 cut(s) 136, 141
TasI AATT 3 cut(s) 62, 117, 484
Tru1I TTAA 3 cut(s) 60, 78, 499
Tru9I TTAA 3 cut(s) 60, 78, 499
TscAI CASTG 1 cut(s) 265
TseFI GTSAC 1 cut(s) 205
Tsp45I GTSAC 1 cut(s) 205
TspDTI ATGAA 1 cut(s) 27
TspRI CASTG 1 cut(s) 265
XapI RAATTY 3 cut(s) 62, 117, 484
XceI RCATGY 1 cut(s) 252
XhoI CTCGAG 1 cut(s) 135
XmiI GTMKAC 1 cut(s) 141
XspI CTAG 2 cut(s) 23, 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.