Rh6CG106200

Cysteine Histidine-rich C1 domain family protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0020290
Physical Location & Seq
Forward (+)
12178058 .. 12178333
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG106200.1

Sequence Viewer

Length: 276 bp
ATGATCATTGACGGGAATCACATATCCCATGAAAGCCACCGCCACCAGCTCAAACTTGAGGACACAAAGTTCCCGTTCAGGTGTGATGGCGGCAAGGTGATAGGCATAGGCAAACGCTACACTTGCACCGCATGTAACTTCGACCTCCACAAGCATTGCCGAGTCGATCCTGATACTCCTATGTTCTACCCGCTGATGCCCAAGTGCAAAAACTTGAAGTTCTGCTTGAGGCCGCCGAAGAACGCCACTATTGCGATGCATGAACCAAGCCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C1_2

Protein Analysis

91

Amino Acids

10.49

Weight (kDa)

9.0

Isoelectric Point (pI)

56.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C1_2 PF03107 12 - 53 2.6e-07 C1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020290)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g07740
rosa_chinensis RchiOBHm_Chr6g0262071 RchiOBHm_Chr6g0271941
rosa_laevigata RLG00000014457
rosa_samantha Rh6CG106200 Rh6DG096600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 40, 90, 129, 191, 233
AclWI GGATC 1 cut(s) 161
AgsI TTSAA 1 cut(s) 217
AloI GAACNNNNNNTCC 2 cut(s) 53, 85
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 1 cut(s) 161
AoxI GGCC 1 cut(s) 230
AsuHPI GGTGA 1 cut(s) 109
BccI CCATC 1 cut(s) 80
BclI TGATCA 1 cut(s) 3
BisI GCNGC 2 cut(s) 91, 233
BlsI GCNGC 2 cut(s) 92, 234
BmsI GCATC 2 cut(s) 186, 246
BpuEI CTTGAG 2 cut(s) 77, 247
Bse3DI GCAATG 1 cut(s) 154
BseMI GCAATG 1 cut(s) 154
BshFI GGCC 1 cut(s) 232
BsnI GGCC 1 cut(s) 232
Bsp143I GATC 2 cut(s) 3, 166
BspACI CCGC 5 cut(s) 40, 90, 129, 191, 233
BspANI GGCC 1 cut(s) 232
BspPI GGATC 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 154
BssMI GATC 2 cut(s) 3, 166
BstKTI GATC 2 cut(s) 6, 169
BstMBI GATC 2 cut(s) 3, 166
BstMWI GCNNNNNNNGC 2 cut(s) 123, 251
BstNSI RCATGY 1 cut(s) 135
BsuRI GGCC 1 cut(s) 232
BtgZI GCGATG 1 cut(s) 269
CspCI CAANNNNNGTGG 2 cut(s) 137, 172
CviAII CATG 3 cut(s) 29, 132, 260
CviJI RGCY 4 cut(s) 36, 49, 232, 270
CviKI_1 RGCY 4 cut(s) 36, 49, 232, 270
DpnI GATC 2 cut(s) 5, 168
DpnII GATC 2 cut(s) 3, 166
EcoT22I ATGCAT 1 cut(s) 261
FaeI CATG 3 cut(s) 32, 135, 263
FaiI YATR 6 cut(s) 23, 30, 107, 133, 182, 261
FalI AAGNNNNNCTT 2 cut(s) 209, 241
FatI CATG 3 cut(s) 28, 131, 259
FauI CCCGC 1 cut(s) 198
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 2 cut(s) 91, 233
Fsp4HI GCNGC 2 cut(s) 91, 233
GluI GCNGC 2 cut(s) 91, 233
HaeIII GGCC 1 cut(s) 232
Hin1II CATG 3 cut(s) 32, 135, 263
HinfI GANTC 2 cut(s) 16, 162
HphI GGTGA 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 170
HpyCH4V TGCA 3 cut(s) 126, 207, 259
HpyF10VI GCNNNNNNNGC 2 cut(s) 123, 251
Hsp92II CATG 3 cut(s) 32, 135, 263
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 166
LpnPI CCDG 3 cut(s) 59, 64, 183
LweI GCATC 2 cut(s) 186, 246
MaeIII GTNAC 1 cut(s) 134
MalI GATC 2 cut(s) 5, 168
MboI GATC 2 cut(s) 3, 166
MboII GAAGA 1 cut(s) 250
MlyI GAGTC 1 cut(s) 171
MnlI CCTC 3 cut(s) 52, 155, 222
Mph1103I ATGCAT 1 cut(s) 261
MspA1I CMGCKG 1 cut(s) 193
MwoI GCNNNNNNNGC 2 cut(s) 123, 251
NdeII GATC 2 cut(s) 3, 166
NlaIII CATG 3 cut(s) 32, 135, 263
NmeAIII GCCGAG 1 cut(s) 185
NsiI ATGCAT 1 cut(s) 261
NspI RCATGY 1 cut(s) 135
PfeI GAWTC 1 cut(s) 16
PkrI GCNGC 2 cut(s) 92, 234
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
SatI GCNGC 2 cut(s) 91, 233
Sau3AI GATC 2 cut(s) 3, 166
SchI GAGTC 1 cut(s) 171
SetI ASST 4 cut(s) 51, 83, 99, 147
SfaNI GCATC 2 cut(s) 186, 246
SmlI CTYRAG 2 cut(s) 56, 226
SmoI CTYRAG 2 cut(s) 56, 226
SsiI CCGC 5 cut(s) 40, 90, 129, 191, 233
TaqI TCGA 2 cut(s) 141, 165
TauI GCSGC 2 cut(s) 93, 235
TfiI GAWTC 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 45, 276
XceI RCATGY 1 cut(s) 135
Zsp2I ATGCAT 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.