Rh6DG274600

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0021460
Physical Location & Seq
Reverse (-)
46849477 .. 46850001
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG274600.1

Sequence Viewer

Length: 417 bp
ATGCATATAATAAATGGCCAGCCAGGGGATCTTTGTCCATGCTCCGACGAGAAAACATATTGTCGAAAAGTGGATTATGGCAAGACGTATCTTCCTCGTATAGTCAATGCAAACATAGATGCTTACCTTTTCTTCGCAGTTGCTCAACACAACCTCACTGTTGTTGGACTAGACGGAGCCAATATCGAACCCATATACACAACCTACATCCTCATAAGCCCTGGACAAACTATGGATGTTTTACTCAAAGCAGATCAGGTTTTTGGGCGCTATTACATGGCTGGTAGACATTTCTCTAGTGATAATGCCAAAGTTTCTGAATTTGACCATGTCAATGTTACTGCAATCTTGGAATACAATGGCAACTATATTTATCCAACATCTCCTCTTTTCCCAAAACCCTTCCTATGTACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00053 ko01100 map00053 map01100
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

138

Amino Acids

15.51

Weight (kDa)

5.7

Isoelectric Point (pI)

45.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase PF00394 2 - 122 1.2e-27 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021460)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0284771
rosa_rugosa Rorug06G0166700
rosa_samantha Rh6CG281600 Rh6CG281800 Rh6DG274600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 286
AclWI GGATC 1 cut(s) 36
AcoI YGGCCR 1 cut(s) 16
AcsI RAATTY 1 cut(s) 320
AfaI GTAC 1 cut(s) 412
AfiI CCNNNNNNNGG 1 cut(s) 25
AjnI CCWGG 2 cut(s) 22, 220
AlwI GGATC 1 cut(s) 36
AoxI GGCC 1 cut(s) 16
ApoI RAATTY 1 cut(s) 320
AspLEI GCGC 1 cut(s) 270
BalI TGGCCA 1 cut(s) 18
BciT130I CCWGG 2 cut(s) 24, 222
BfaI CTAG 2 cut(s) 170, 297
BfoI RGCGCY 1 cut(s) 271
Bme1390I CCNGG 2 cut(s) 24, 222
BmiI GGNNCC 1 cut(s) 178
BmrFI CCNGG 2 cut(s) 24, 222
BmsI GCATC 1 cut(s) 109
BsaJI CCNNGG 2 cut(s) 23, 220
Bsc4I CCNNNNNNNGG 1 cut(s) 25
BseBI CCWGG 2 cut(s) 24, 222
BseDI CCNNGG 2 cut(s) 23, 220
BseGI GGATG 2 cut(s) 207, 241
BseLI CCNNNNNNNGG 1 cut(s) 25
BseRI GAGGAG 1 cut(s) 375
BshFI GGCC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 25
BsnI GGCC 1 cut(s) 18
Bsp143I GATC 2 cut(s) 28, 253
BspANI GGCC 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 178
BspPI GGATC 1 cut(s) 36
BssECI CCNNGG 2 cut(s) 23, 220
BssMI GATC 2 cut(s) 28, 253
Bst2UI CCWGG 2 cut(s) 24, 222
Bst4CI ACNGT 1 cut(s) 160
BstC8I GCNNGC 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 414
BstF5I GGATG 2 cut(s) 207, 241
BstH2I RGCGCY 1 cut(s) 271
BstHHI GCGC 1 cut(s) 270
BstKTI GATC 2 cut(s) 31, 256
BstMBI GATC 2 cut(s) 28, 253
BstNI CCWGG 2 cut(s) 24, 222
BstSCI CCNGG 2 cut(s) 22, 220
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
BsuRI GGCC 1 cut(s) 18
BtsCI GGATG 2 cut(s) 207, 241
BtsIMutI CAGTG 1 cut(s) 156
Cac8I GCNNGC 1 cut(s) 20
CfoI GCGC 1 cut(s) 270
Csp6I GTAC 1 cut(s) 411
CviAII CATG 3 cut(s) 39, 277, 329
CviJI RGCY 5 cut(s) 18, 22, 179, 219, 281
CviKI_1 RGCY 5 cut(s) 18, 22, 179, 219, 281
CviQI GTAC 1 cut(s) 411
DdeI CTNAG 1 cut(s) 414
DpnI GATC 2 cut(s) 30, 255
DpnII GATC 2 cut(s) 28, 253
EaeI YGGCCR 1 cut(s) 16
EcoRII CCWGG 2 cut(s) 22, 220
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 42, 280, 332
FatI CATG 3 cut(s) 38, 276, 328
FblI GTMKAC 1 cut(s) 286
FokI GGATG 2 cut(s) 194, 248
FspBI CTAG 2 cut(s) 170, 297
GlaI GCGC 1 cut(s) 269
HaeII RGCGCY 1 cut(s) 271
HaeIII GGCC 1 cut(s) 18
HhaI GCGC 1 cut(s) 270
Hin1II CATG 3 cut(s) 42, 280, 332
Hin6I GCGC 1 cut(s) 268
HinP1I GCGC 1 cut(s) 268
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 2 cut(s) 46, 319
Hpy8I GTNNAC 1 cut(s) 287
Hpy99I CGWCG 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 412
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4IV ACGT 1 cut(s) 86
HpyCH4V TGCA 3 cut(s) 4, 110, 344
HpyF3I CTNAG 1 cut(s) 414
HpySE526I ACGT 1 cut(s) 86
Hsp92II CATG 3 cut(s) 42, 280, 332
HspAI GCGC 1 cut(s) 268
Kzo9I GATC 2 cut(s) 28, 253
LmnI GCTCC 2 cut(s) 47, 176
LpnPI CCDG 7 cut(s) 9, 32, 36, 207, 234, 242, 267
LweI GCATC 1 cut(s) 109
MaeI CTAG 2 cut(s) 170, 297
MaeII ACGT 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 337
MalI GATC 2 cut(s) 30, 255
MboI GATC 2 cut(s) 28, 253
MboII GAAGA 2 cut(s) 83, 124
MflI RGATCY 1 cut(s) 28
MlsI TGGCCA 1 cut(s) 18
MluCI AATT 1 cut(s) 320
MluNI TGGCCA 1 cut(s) 18
MmeI TCCRAC 3 cut(s) 69, 145, 401
MnlI CCTC 4 cut(s) 105, 164, 221, 396
Mox20I TGGCCA 1 cut(s) 18
Mph1103I ATGCAT 1 cut(s) 6
MscI TGGCCA 1 cut(s) 18
MslI CAYNNNNRTG 1 cut(s) 333
Msp20I TGGCCA 1 cut(s) 18
MspR9I CCNGG 2 cut(s) 24, 222
MvaI CCWGG 2 cut(s) 24, 222
NdeII GATC 2 cut(s) 28, 253
NlaIII CATG 3 cut(s) 42, 280, 332
NlaIV GGNNCC 1 cut(s) 178
NsiI ATGCAT 1 cut(s) 6
PflFI GACNNNGTC 1 cut(s) 329
Psp6I CCWGG 2 cut(s) 22, 220
PspGI CCWGG 2 cut(s) 22, 220
PspN4I GGNNCC 1 cut(s) 178
PsuI RGATCY 1 cut(s) 28
PsyI GACNNNGTC 1 cut(s) 329
RsaI GTAC 1 cut(s) 412
RsaNI GTAC 1 cut(s) 411
RseI CAYNNNNRTG 1 cut(s) 333
Sau3AI GATC 2 cut(s) 28, 253
ScrFI CCNGG 2 cut(s) 24, 222
SetI ASST 5 cut(s) 89, 129, 156, 206, 261
SfaNI GCATC 1 cut(s) 109
SmiMI CAYNNNNRTG 1 cut(s) 333
Sse9I AATT 1 cut(s) 320
SspMI CTAG 2 cut(s) 170, 297
StyD4I CCNGG 2 cut(s) 22, 220
TaaI ACNGT 1 cut(s) 160
TaiI ACGT 1 cut(s) 89
TaqI TCGA 2 cut(s) 64, 186
TasI AATT 1 cut(s) 320
TatI WGTACW 1 cut(s) 410
TscAI CASTG 1 cut(s) 163
TspGWI ACGGA 1 cut(s) 189
TspRI CASTG 1 cut(s) 163
Tth111I GACNNNGTC 1 cut(s) 329
XapI RAATTY 1 cut(s) 320
XmiI GTMKAC 1 cut(s) 286
XspI CTAG 2 cut(s) 170, 297
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.