Rh7AG246600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
24326426 .. 24327501
1076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG246600.1

Sequence Viewer

Length: 333 bp
ATGGTTTCCCGTGTATTGATTTGGATTCCTTCTTGTCAGTATTCAAGATTTCAGGACTTCACGAAAAATACTATCATAACACTGGTCACCTATCTAGTGGAGGGGATACTTTTGTTGATGAAGCTGTCATTGCAGCAGCAAGAGCATTGCCTACTTGGTCAGATGGGGATATGTCTCCAATCCAAGCATGGAAAGACGAGAGACAAAGGAATTATAGGAAGAATGTCAATAAATGCTTGCTGCATTCCTAACAACTCTAAGGAATTCAAAAATATCCTTGATGATGTGAAACTTGACAACATACTCAATGAGAAGATGGCTTTAGTTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.56

Weight (kDa)

8.9

Isoelectric Point (pI)

50.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022721)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0401771
rosa_samantha Rh3BG299600 Rh7AG246600 Rh7BG186700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 263
AgsI TTSAA 3 cut(s) 45, 268, 329
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
Alw26I GTCTC 2 cut(s) 179, 195
ApeKI GCWGC 3 cut(s) 133, 136, 240
ApoI RAATTY 1 cut(s) 263
AsuHPI GGTGA 1 cut(s) 79
BaeI ACNNNNGTAYC 2 cut(s) 98, 131
BbvI GCAGC 3 cut(s) 145, 148, 227
BccI CCATC 2 cut(s) 157, 310
BciVI GTATCC 1 cut(s) 99
BcoDI GTCTC 2 cut(s) 179, 195
BfaI CTAG 1 cut(s) 95
BfuI GTATCC 1 cut(s) 99
BisI GCNGC 3 cut(s) 134, 137, 241
BlsI GCNGC 3 cut(s) 135, 138, 242
Bse1I ACTGG 1 cut(s) 87
Bse3DI GCAATG 2 cut(s) 128, 145
BseMI GCAATG 2 cut(s) 128, 145
BseNI ACTGG 1 cut(s) 87
BseXI GCAGC 3 cut(s) 145, 148, 227
BsmAI GTCTC 2 cut(s) 179, 195
BsmI GAATGC 1 cut(s) 243
BsrDI GCAATG 2 cut(s) 128, 145
BsrI ACTGG 1 cut(s) 87
BstC8I GCNNGC 1 cut(s) 238
BstDEI CTNAG 1 cut(s) 258
BstEII GGTNACC 1 cut(s) 85
BstMAI GTCTC 2 cut(s) 179, 195
BstMWI GCNNNNNNNGC 2 cut(s) 130, 142
BstPI GGTNACC 1 cut(s) 85
BstV1I GCAGC 3 cut(s) 145, 148, 227
BsuI GTATCC 1 cut(s) 99
BtsIMutI CAGTG 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 238
CviAII CATG 1 cut(s) 188
CviJI RGCY 2 cut(s) 124, 320
CviKI_1 RGCY 2 cut(s) 124, 320
DdeI CTNAG 1 cut(s) 258
Eco91I GGTNACC 1 cut(s) 85
EcoO65I GGTNACC 1 cut(s) 85
EcoRI GAATTC 1 cut(s) 263
FaeI CATG 1 cut(s) 191
FaiI YATR 5 cut(s) 77, 172, 189, 215, 302
FatI CATG 1 cut(s) 187
Fnu4HI GCNGC 3 cut(s) 134, 137, 241
Fsp4HI GCNGC 3 cut(s) 134, 137, 241
FspBI CTAG 1 cut(s) 95
GluI GCNGC 3 cut(s) 134, 137, 241
Hin1II CATG 1 cut(s) 191
HinfI GANTC 1 cut(s) 25
HphI GGTGA 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 3 cut(s) 45, 53, 61
HpyAV CCTTC 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 133, 243
HpyF10VI GCNNNNNNNGC 2 cut(s) 130, 142
HpyF3I CTNAG 1 cut(s) 258
Hsp92II CATG 1 cut(s) 191
LpnPI CCDG 2 cut(s) 38, 68
Lsp1109I GCAGC 3 cut(s) 145, 148, 227
MaeI CTAG 1 cut(s) 95
MaeIII GTNAC 1 cut(s) 85
MboII GAAGA 2 cut(s) 231, 325
MluCI AATT 2 cut(s) 210, 263
MnlI CCTC 1 cut(s) 94
Mva1269I GAATGC 1 cut(s) 243
MwoI GCNNNNNNNGC 2 cut(s) 130, 142
NlaIII CATG 1 cut(s) 191
NmuCI GTSAC 1 cut(s) 85
PctI GAATGC 1 cut(s) 243
PfeI GAWTC 1 cut(s) 25
PkrI GCNGC 3 cut(s) 135, 138, 242
PspEI GGTNACC 1 cut(s) 85
SatI GCNGC 3 cut(s) 134, 137, 241
SetI ASST 2 cut(s) 92, 126
Sse9I AATT 2 cut(s) 210, 263
SspMI CTAG 1 cut(s) 95
TasI AATT 2 cut(s) 210, 263
TfiI GAWTC 1 cut(s) 25
TscAI CASTG 1 cut(s) 87
TseFI GTSAC 1 cut(s) 85
TseI GCWGC 3 cut(s) 133, 136, 240
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 134
TspRI CASTG 1 cut(s) 87
XapI RAATTY 1 cut(s) 263
XcmI CCANNNNNNNNNTGG 1 cut(s) 185
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.