Rw1G018560

Belongs to the ATG8 family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
40910885 .. 40913935
3051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G018560.1

Sequence Viewer

Length: 354 bp
ATGACGAAAAGCACCTTCAAGCAAGCACACGAGTTTGAGAAGAGGCGTGCTGAGGCCTCGAGGATTAGAGAGAAGTACCCAGATAGAATTCCAGTGATTGTGGAGAAGGCAGAGAGAAGTGATATTCCCAACATTGACAAGAAAAAATACCTAGTACCAGCTGATTTGACTGTTGGTCAATTTGTCTATGTCATCCGCAAGAGAATCAAACTGAGTGCAGAAAAGGCCATCTTCATATTTGTGGACAATGTCCTCCCACCTACAGGAGCAGTAATGTCTACTATCTATGATGAAAAGAAGGATGGTGATGGATTTCTATACGTTTCATACAGTGGTGAAAACACATTCGGGTAG
Functional Annotation

Protein Analysis

117

Amino Acids

13.42

Weight (kDa)

9.27

Isoelectric Point (pI)

34.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATG8 PF02991 14 - 117 5e-50 Autophagy protein Atg8 ubiquitin like
APG12 PF04110 40 - 117 6e-07 Ubiquitin-like autophagy protein Apg12
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015800)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45170 AT2G45170 AT3G60640
fragaria_vesca FvH4_7g11130
malus_domestica MD02G1210100.v1.1 MD07G1116100.v1.1
rosa_chinensis RchiOBHm_Chr1g0349151
rosa_laevigata RLG00000028600
rosa_multiflora Rmu_ssc0000150.1_g000016
rosa_roxburghii Rroxscaffold_4G00306060
rosa_rugosa Rorug01G0200800 Rorug01G0200900 Rorug01G0201000
rosa_samantha Rh1AG218500
rosa_wichuraiana Rw1G018560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 58
AccI GTMKAC 1 cut(s) 278
AciI CCGC 1 cut(s) 196
AcsI RAATTY 1 cut(s) 87
AfaI GTAC 2 cut(s) 77, 156
AfiI CCNNNNNNNGG 1 cut(s) 263
AgsI TTSAA 1 cut(s) 19
AhdI GACNNNNNGTC 1 cut(s) 174
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Ama87I CYCGRG 1 cut(s) 58
AoxI GGCC 2 cut(s) 54, 225
ApoI RAATTY 1 cut(s) 87
AsuHPI GGTGA 2 cut(s) 317, 347
AvaI CYCGRG 1 cut(s) 58
BauI CACGAG 1 cut(s) 29
BbvCI CCTCAGC 1 cut(s) 51
BccI CCATC 3 cut(s) 236, 296, 302
BfaI CTAG 1 cut(s) 152
BfmI CTRYAG 1 cut(s) 261
BmeRI GACNNNNNGTC 1 cut(s) 174
BmeT110I CYCGRG 1 cut(s) 58
Bpu10I CCTNAGC 1 cut(s) 51
Bsc4I CCNNNNNNNGG 1 cut(s) 263
Bse1I ACTGG 1 cut(s) 92
BseGI GGATG 2 cut(s) 192, 307
BseLI CCNNNNNNNGG 1 cut(s) 263
BseMII CTCAG 2 cut(s) 42, 203
BseNI ACTGG 1 cut(s) 92
BsgI GTGCAG 1 cut(s) 237
BshFI GGCC 2 cut(s) 56, 227
BsiHKCI CYCGRG 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 263
BsnI GGCC 2 cut(s) 56, 227
BsoBI CYCGRG 1 cut(s) 58
BspACI CCGC 1 cut(s) 196
BspANI GGCC 2 cut(s) 56, 227
BspCNI CTCAG 2 cut(s) 43, 204
BsrI ACTGG 1 cut(s) 92
BssSI CACGAG 1 cut(s) 29
Bst2BI CACGAG 1 cut(s) 29
Bst4CI ACNGT 2 cut(s) 172, 332
Bst6I CTCTTC 1 cut(s) 35
BstC8I GCNNGC 2 cut(s) 24, 48
BstDEI CTNAG 2 cut(s) 51, 212
BstF5I GGATG 2 cut(s) 192, 307
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstSFI CTRYAG 1 cut(s) 261
BsuRI GGCC 2 cut(s) 56, 227
BtsCI GGATG 2 cut(s) 192, 307
BtsIMutI CAGTG 2 cut(s) 99, 337
Cac8I GCNNGC 2 cut(s) 24, 48
Csp6I GTAC 2 cut(s) 76, 155
CviJI RGCY 3 cut(s) 56, 161, 227
CviKI_1 RGCY 3 cut(s) 56, 161, 227
CviQI GTAC 2 cut(s) 76, 155
DdeI CTNAG 2 cut(s) 51, 212
DriI GACNNNNNGTC 1 cut(s) 174
Eam1104I CTCTTC 1 cut(s) 35
Eam1105I GACNNNNNGTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 35
Eco147I AGGCCT 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 58
EcoRI GAATTC 1 cut(s) 87
FaiI YATR 5 cut(s) 189, 236, 288, 319, 328
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FblI GTMKAC 1 cut(s) 278
FokI GGATG 2 cut(s) 179, 314
FspBI CTAG 1 cut(s) 152
HaeIII GGCC 2 cut(s) 56, 227
HinfI GANTC 1 cut(s) 204
HphI GGTGA 2 cut(s) 317, 347
Hpy166II GTNNAC 2 cut(s) 244, 279
Hpy8I GTNNAC 2 cut(s) 244, 279
HpyAV CCTTC 3 cut(s) 25, 100, 292
HpyCH4III ACNGT 2 cut(s) 172, 332
HpyCH4IV ACGT 1 cut(s) 321
HpyCH4V TGCA 1 cut(s) 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 2 cut(s) 51, 212
HpySE526I ACGT 1 cut(s) 321
LmnI GCTCC 1 cut(s) 266
LpnPI CCDG 4 cut(s) 93, 105, 171, 249
MaeI CTAG 1 cut(s) 152
MaeII ACGT 1 cut(s) 321
MboII GAAGA 2 cut(s) 52, 223
MluCI AATT 2 cut(s) 87, 179
MnlI CCTC 5 cut(s) 36, 46, 54, 67, 263
MslI CAYNNNNRTG 1 cut(s) 239
MspA1I CMGCKG 1 cut(s) 161
MwoI GCNNNNNNNGC 1 cut(s) 224
PaeR7I CTCGAG 1 cut(s) 58
PceI AGGCCT 1 cut(s) 56
PfeI GAWTC 1 cut(s) 204
PflFI GACNNNGTC 1 cut(s) 248
PspXI VCTCGAGB 1 cut(s) 58
PsyI GACNNNGTC 1 cut(s) 248
PvuII CAGCTG 1 cut(s) 161
RsaI GTAC 2 cut(s) 77, 156
RsaNI GTAC 2 cut(s) 76, 155
RseI CAYNNNNRTG 1 cut(s) 239
SetI ASST 5 cut(s) 17, 153, 163, 262, 324
SfcI CTRYAG 1 cut(s) 261
Sfr274I CTCGAG 1 cut(s) 58
SlaI CTCGAG 1 cut(s) 58
SmiMI CAYNNNNRTG 1 cut(s) 239
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 2 cut(s) 87, 179
SseBI AGGCCT 1 cut(s) 56
SsiI CCGC 1 cut(s) 196
SspMI CTAG 1 cut(s) 152
StuI AGGCCT 1 cut(s) 56
TaaI ACNGT 2 cut(s) 172, 332
TaiI ACGT 1 cut(s) 324
TaqI TCGA 1 cut(s) 59
TasI AATT 2 cut(s) 87, 179
TfiI GAWTC 1 cut(s) 204
TscAI CASTG 2 cut(s) 99, 337
TspDTI ATGAA 3 cut(s) 223, 306, 315
TspRI CASTG 2 cut(s) 99, 337
Tth111I GACNNNGTC 1 cut(s) 248
XapI RAATTY 1 cut(s) 87
XhoI CTCGAG 1 cut(s) 58
XmiI GTMKAC 1 cut(s) 278
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.