AT1G10250

Paired amphipathic helix protein Sin3-like

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
3360087 .. 3360508
422 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G10250.1

Sequence Viewer

Length: 234 bp
ATGGATGCACTCTATAATTTACTTGACGGTTCTATTGACGACAATACAAAGTTTGAAGATGAGTGCCGAGCTATTTTTGGAGCACAGTCATATGTTCTTTTCACATTGGACAAGCTAGTTCAGAAGTTTGTTAAGCATCTCCATGCAGTTGCATCTGATGAAACAGACACCAAGCTTCTGCAACTACATGCGTATGAGAACTACAGAAAACTTTGGGAAGATGATTTGATCTAG

Protein Analysis

77

Amino Acids

9.0

Weight (kDa)

4.63

Isoelectric Point (pI)

21.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sin3a_C PF16879 2 - 68 2.7e-18 C-terminal domain of Sin3a protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 56
AluBI AGCT 3 cut(s) 71, 115, 175
AluI AGCT 3 cut(s) 71, 115, 175
Alw21I GWGCWC 1 cut(s) 85
Bbv12I GWGCWC 1 cut(s) 85
BfaI CTAG 2 cut(s) 116, 232
BfmI CTRYAG 1 cut(s) 202
BmsI GCATC 2 cut(s) 145, 161
BseGI GGATG 1 cut(s) 10
BsiHKAI GWGCWC 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 85
Bsp143I GATC 1 cut(s) 228
BssMI GATC 1 cut(s) 228
Bst4CI ACNGT 2 cut(s) 29, 87
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 231
BstMBI GATC 1 cut(s) 228
BstNSI RCATGY 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 202
BtsCI GGATG 1 cut(s) 10
CviAII CATG 2 cut(s) 143, 188
CviJI RGCY 3 cut(s) 71, 115, 175
CviKI_1 RGCY 3 cut(s) 71, 115, 175
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
FaeI CATG 2 cut(s) 146, 191
FaiI YATR 6 cut(s) 15, 91, 93, 144, 189, 195
FatI CATG 2 cut(s) 142, 187
FauNDI CATATG 1 cut(s) 91
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 116, 232
FspEI CC 8 cut(s) 12, 63, 80, 92, 155, 184, 199, 200
Hin1II CATG 2 cut(s) 146, 191
HindIII AAGCTT 1 cut(s) 173
Hpy188I TCNGA 2 cut(s) 123, 157
HpyCH4III ACNGT 2 cut(s) 29, 87
HpyCH4V TGCA 4 cut(s) 8, 146, 152, 181
Hsp92II CATG 2 cut(s) 146, 191
Kzo9I GATC 1 cut(s) 228
LmnI GCTCC 1 cut(s) 80
LweI GCATC 2 cut(s) 145, 161
MaeI CTAG 2 cut(s) 116, 232
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MboII GAAGA 2 cut(s) 68, 230
MhlI GDGCHC 1 cut(s) 85
MluCI AATT 1 cut(s) 16
MseI TTAA 1 cut(s) 132
MslI CAYNNNNRTG 2 cut(s) 141, 192
NdeI CATATG 1 cut(s) 91
NdeII GATC 1 cut(s) 228
NlaIII CATG 2 cut(s) 146, 191
NmeAIII GCCGAG 1 cut(s) 92
NspI RCATGY 1 cut(s) 191
RseI CAYNNNNRTG 2 cut(s) 141, 192
SaqAI TTAA 1 cut(s) 132
Sau3AI GATC 1 cut(s) 228
SduI GDGCHC 1 cut(s) 85
SetI ASST 3 cut(s) 73, 117, 177
SfaNI GCATC 2 cut(s) 145, 161
SfcI CTRYAG 1 cut(s) 202
SgeI CNNG 7 cut(s) 35, 80, 124, 128, 155, 184, 200
SmiMI CAYNNNNRTG 2 cut(s) 141, 192
Sse9I AATT 1 cut(s) 16
SspMI CTAG 2 cut(s) 116, 232
TaaI ACNGT 2 cut(s) 29, 87
TasI AATT 1 cut(s) 16
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 1 cut(s) 174
XceI RCATGY 1 cut(s) 191
XspI CTAG 2 cut(s) 116, 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.