AT2G06255

Protein of unknown function (DUF1313)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
2457573 .. 2459940
2368 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G06255.1

Sequence Viewer

Length: 330 bp
ATGGAGGGAGACACAATATCTAGGATGATGGGAAGTGGAGTTCAAATGGATGGGAAGATTCTTCAAACGTTTGAGAAAAGTTTTGTTCAAGTGCAAAACATATTGGACCACAACAGATTGCTTATAAACGAGATAAACCAAAACCATGAGTCCAAAATCCCGGACAACCTCGGACGAAACGTCGGTTTGATCCGAGAATTGAACAATAACGTGAGAAGGGTTGCTCATCTTTATGTCGATCTTTCCAACAACTTCTCCAAATCCATGGAAGCTTCTTCTGAAGGAGACTCATCAGAAGGACGAGGTAACAGAAGAATCAGGCCTGCTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.31

Weight (kDa)

6.84

Isoelectric Point (pI)

40.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Elf4 PF07011 15 - 96 1.8e-38 Early Flowering 4 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 125
AclI AACGTT 1 cut(s) 68
AclWI GGATC 1 cut(s) 184
AcuI CTGAAG 1 cut(s) 300
AgsI TTSAA 4 cut(s) 44, 65, 89, 202
AhdI GACNNNNNGTC 1 cut(s) 179
AloI GAACNNNNNNTCC 2 cut(s) 24, 56
AluBI AGCT 1 cut(s) 272
AluI AGCT 1 cut(s) 272
Alw26I GTCTC 2 cut(s) 3, 279
AlwI GGATC 1 cut(s) 184
AoxI GGCC 1 cut(s) 320
AspS9I GGNCC 1 cut(s) 106
AsuC2I CCSGG 1 cut(s) 161
AvaII GGWCC 1 cut(s) 106
BccI CCATC 2 cut(s) 22, 44
BcnI CCSGG 1 cut(s) 161
BcoDI GTCTC 2 cut(s) 3, 279
BfaI CTAG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 106
BmeRI GACNNNNNGTC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 161
BpuMI CCSGG 1 cut(s) 161
BsaJI CCNNGG 2 cut(s) 169, 264
BsaXI ACNNNNNCTCC 2 cut(s) 239, 269
BseDI CCNNGG 2 cut(s) 169, 264
BseGI GGATG 2 cut(s) 30, 55
BshFI GGCC 1 cut(s) 322
BsiSI CCGG 1 cut(s) 161
BsmAI GTCTC 2 cut(s) 3, 279
BsnI GGCC 1 cut(s) 322
Bsp143I GATC 2 cut(s) 189, 238
Bsp19I CCATGG 1 cut(s) 264
BspANI GGCC 1 cut(s) 322
BspPI GGATC 1 cut(s) 184
BssECI CCNNGG 2 cut(s) 169, 264
BssMI GATC 2 cut(s) 189, 238
BssT1I CCWWGG 1 cut(s) 264
BstC8I GCNNGC 1 cut(s) 324
BstDSI CCRYGG 1 cut(s) 264
BstF5I GGATG 2 cut(s) 30, 55
BstKTI GATC 2 cut(s) 192, 241
BstMAI GTCTC 2 cut(s) 3, 279
BstMBI GATC 2 cut(s) 189, 238
BstSCI CCNGG 1 cut(s) 159
BstXI CCANNNNNNTGG 1 cut(s) 265
BsuRI GGCC 1 cut(s) 322
BtgI CCRYGG 1 cut(s) 264
BtsCI GGATG 2 cut(s) 30, 55
Cac8I GCNNGC 1 cut(s) 324
Cfr13I GGNCC 1 cut(s) 106
CviAII CATG 2 cut(s) 146, 265
CviJI RGCY 2 cut(s) 272, 322
CviKI_1 RGCY 2 cut(s) 272, 322
DpnI GATC 2 cut(s) 191, 240
DpnII GATC 2 cut(s) 189, 238
DriI GACNNNNNGTC 1 cut(s) 179
Eam1105I GACNNNNNGTC 1 cut(s) 179
Eco130I CCWWGG 1 cut(s) 264
Eco147I AGGCCT 1 cut(s) 322
Eco47I GGWCC 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 300
EcoT14I CCWWGG 1 cut(s) 264
ErhI CCWWGG 1 cut(s) 264
FaeI CATG 2 cut(s) 149, 268
FaiI YATR 5 cut(s) 101, 125, 147, 234, 266
FatI CATG 2 cut(s) 145, 264
FokI GGATG 2 cut(s) 37, 62
FspBI CTAG 1 cut(s) 21
HaeIII GGCC 1 cut(s) 322
HapII CCGG 1 cut(s) 161
Hin1II CATG 2 cut(s) 149, 268
HindIII AAGCTT 1 cut(s) 270
HinfI GANTC 4 cut(s) 58, 149, 287, 315
HpaII CCGG 1 cut(s) 161
Hpy188I TCNGA 4 cut(s) 173, 194, 280, 295
Hpy99I CGWCG 1 cut(s) 185
HpyAV CCTTC 3 cut(s) 210, 275, 290
HpyCH4IV ACGT 3 cut(s) 68, 180, 210
HpyCH4V TGCA 1 cut(s) 94
HpySE526I ACGT 3 cut(s) 68, 180, 210
Hsp92II CATG 2 cut(s) 149, 268
Kzo9I GATC 2 cut(s) 189, 238
LpnPI CCDG 2 cut(s) 174, 304
MaeI CTAG 1 cut(s) 21
MaeII ACGT 3 cut(s) 68, 180, 210
MaeIII GTNAC 1 cut(s) 305
MalI GATC 2 cut(s) 191, 240
MboI GATC 2 cut(s) 189, 238
MboII GAAGA 4 cut(s) 53, 67, 267, 324
MluCI AATT 1 cut(s) 197
MlyI GAGTC 2 cut(s) 158, 281
MmeI TCCRAC 1 cut(s) 270
MnlI CCTC 2 cut(s) 179, 296
MseI TTAA 1 cut(s) 328
MslI CAYNNNNRTG 1 cut(s) 231
MspI CCGG 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 161
NciI CCSGG 1 cut(s) 161
NcoI CCATGG 1 cut(s) 264
NdeII GATC 2 cut(s) 189, 238
NlaIII CATG 2 cut(s) 149, 268
PceI AGGCCT 1 cut(s) 322
PcsI WCGNNNNNNNCGW 1 cut(s) 177
PfeI GAWTC 2 cut(s) 58, 315
PfoI TCCNGGA 1 cut(s) 159
PleI GAGTC 2 cut(s) 157, 281
PpsI GAGTC 2 cut(s) 157, 281
PsiI TTATAA 1 cut(s) 125
Psp1406I AACGTT 1 cut(s) 68
PspPI GGNCC 1 cut(s) 106
RseI CAYNNNNRTG 1 cut(s) 231
SaqAI TTAA 1 cut(s) 328
Sau3AI GATC 2 cut(s) 189, 238
Sau96I GGNCC 1 cut(s) 106
SchI GAGTC 2 cut(s) 158, 281
ScrFI CCNGG 1 cut(s) 161
SetI ASST 6 cut(s) 71, 171, 183, 213, 274, 307
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 231
Sse9I AATT 1 cut(s) 197
SseBI AGGCCT 1 cut(s) 322
SspMI CTAG 1 cut(s) 21
StuI AGGCCT 1 cut(s) 322
StyD4I CCNGG 1 cut(s) 159
StyI CCWWGG 1 cut(s) 264
TaiI ACGT 3 cut(s) 71, 183, 213
TaqI TCGA 1 cut(s) 237
TasI AATT 1 cut(s) 197
TfiI GAWTC 2 cut(s) 58, 315
Tru1I TTAA 1 cut(s) 328
Tru9I TTAA 1 cut(s) 328
VpaK11BI GGWCC 1 cut(s) 106
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.