AT3G28530

UDP-D-glucose UDP-D-galactose 4-epimerase

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
10690637 .. 10690714
78 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G28530.1

Sequence Viewer

Length: 78 bp
ATGTGTAGGGATCTATGGAATTGGGCAAGCAATAACCCTTACGGCTACAATTCCTCCTCCAACGGCTCCTCTTCATAA

Protein Analysis

25

Amino Acids

2.8

Weight (kDa)

5.58

Isoelectric Point (pI)

30.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022090)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G28530
rosa_chinensis RchiOBHm_Chr7g0194541
rosa_laevigata RLG00000004192
rosa_multiflora Rmu_sc0004908.1_g000007

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 18
AlwI GGATC 1 cut(s) 18
BceAI ACGGC 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 38, 68
BseRI GAGGAG 2 cut(s) 46, 58
Bsp143I GATC 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 67
BspPI GGATC 1 cut(s) 18
BssMI GATC 1 cut(s) 10
BstC8I GCNNGC 1 cut(s) 28
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 10
BstYI RGATCY 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 28
CviJI RGCY 2 cut(s) 45, 66
CviKI_1 RGCY 2 cut(s) 45, 66
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
FaiI YATR 2 cut(s) 16, 76
FspEI CC 9 cut(s) 7, 8, 27, 48, 50, 51, 67, 70, 73
Kzo9I GATC 1 cut(s) 10
LmnI GCTCC 1 cut(s) 71
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MboII GAAGA 1 cut(s) 63
MflI RGATCY 1 cut(s) 10
MluCI AATT 2 cut(s) 19, 49
MnlI CCTC 2 cut(s) 64, 67
MspJI CNNR 6 cut(s) 8, 9, 27, 39, 51, 72
NdeII GATC 1 cut(s) 10
NlaIV GGNNCC 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 67
PsuI RGATCY 1 cut(s) 10
Sau3AI GATC 1 cut(s) 10
SgeI CNNG 1 cut(s) 39
Sse9I AATT 2 cut(s) 19, 49
TasI AATT 2 cut(s) 19, 49
TspDTI ATGAA 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.