AT4G14640

Cytoskeletal-regulatory complex EF hand

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
8397693 .. 8400226
2534 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G14640.2

Sequence Viewer

Length: 456 bp
ATGGAAGAAACAGCACTGACAAAAGATCAGATCACTGAGTTCAAAGAAGCCTTTTGTCTCTTCGACAAAGACGGCGACGGTTGTATAACGGTGGAAGAACTTGCAACAGTGATCCGTTCGTTGGATCAGAATCCGACAGAACAAGAACTTCATGATATCATCACTGAGATTGATTCTGATAGCAACGGCACCATTGAATTTGCTGAGTTTCTCAACCTCATGGCCAAAAAACTTCAGGAAAGTGATGCGGAGGAAGAGCTGAAAGAAGCATTCAAAGTCTTTGACAAAGACCAAAATGGATACATCTCTGCCAGTGAGTTGAGTCATGTAATGATAAATCTAGGAGAAAAGCTAACAGATGAAGAAGTTGAACAAATGATAAAGGAGGCAGATTTGGATGGTGATGGCCAAGTCAATTATGATGAATTTGTCAAGATGATGATCAACATTGACTGA

Protein Analysis

151

Amino Acids

17.16

Weight (kDa)

4.05

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 9 - 56 5.1e-09 EF-hand domain pair
EF-hand_8 PF13833 9 - 58 2e-09 EF-hand domain pair
EF-hand_1 PF00036 31 - 58 4.4e-06 EF hand domain
EF-hand_7 PF13499 66 - 129 6.5e-22 EF-hand domain pair
AIF-1 PF21008 67 - 130 8.3e-06 Allograft inflammatory factor 1
EF-hand_1 PF00036 68 - 95 1.4e-08 EF hand domain
EF-hand_6 PF13405 68 - 97 1.4e-08 EF-hand domain
EF-hand_5 PF13202 69 - 93 4.4e-06 EF hand
EF-hand_9 PF14658 71 - 129 1.9e-06 EF-hand domain
EF-hand_8 PF13833 84 - 129 3.8e-09 EF-hand domain pair
EF-hand_1 PF00036 104 - 130 1e-08 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015499)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G14640
fragaria_vesca FvH4_2g22870
malus_domestica MD03G1257100.v1.1 MD11G1277800.v1.1
prunus_persica Prupe.8G234000_v2.0.a1
pyrus_communis pycom03g20380 pycom11g24560
rosa_chinensis RchiOBHm_Chr6g0289811
rosa_laevigata RLG00000012266
rosa_roxburghii Rroxscaffold_7G00177540 Rroxscaffold_7G00178060
rosa_rugosa Rorug06G0207100
rosa_samantha Rh6BG325800 Rh6CG331800 Rh6DG317100
rosa_wichuraiana Rw6G027480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 188
AciI CCGC 1 cut(s) 248
AclWI GGATC 2 cut(s) 106, 132
AcoI YGGCCR 2 cut(s) 222, 406
AcsI RAATTY 2 cut(s) 197, 425
AcuI CTGAAG 1 cut(s) 218
AfiI CCNNNNNNNGG 1 cut(s) 121
AgsI TTSAA 4 cut(s) 43, 197, 274, 371
AluBI AGCT 2 cut(s) 259, 352
AluI AGCT 2 cut(s) 259, 352
Alw26I GTCTC 1 cut(s) 62
AlwI GGATC 2 cut(s) 106, 132
AoxI GGCC 2 cut(s) 222, 406
ApoI RAATTY 2 cut(s) 197, 425
AsuHPI GGTGA 1 cut(s) 413
BalI TGGCCA 2 cut(s) 224, 408
BanI GGYRCC 1 cut(s) 188
BccI CCATC 2 cut(s) 392, 398
BceAI ACGGC 2 cut(s) 88, 202
BciVI GTATCC 1 cut(s) 293
BclI TGATCA 1 cut(s) 441
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 1 cut(s) 341
BfuI GTATCC 1 cut(s) 293
BmiI GGNNCC 1 cut(s) 190
BmsI GCATC 1 cut(s) 235
BsaBI GATNNNNATC 2 cut(s) 129, 440
Bsc4I CCNNNNNNNGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 312
Bse8I GATNNNNATC 2 cut(s) 129, 440
BseGI GGATG 1 cut(s) 403
BseJI GATNNNNATC 2 cut(s) 129, 440
BseLI CCNNNNNNNGG 1 cut(s) 121
BseMII CTCAG 3 cut(s) 27, 156, 195
BseNI ACTGG 1 cut(s) 312
BshFI GGCC 2 cut(s) 224, 408
BshNI GGYRCC 1 cut(s) 188
BslI CCNNNNNNNGG 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 62
BsmI GAATGC 1 cut(s) 269
BsnI GGCC 2 cut(s) 224, 408
Bsp143I GATC 5 cut(s) 25, 30, 111, 124, 441
BspACI CCGC 1 cut(s) 248
BspANI GGCC 2 cut(s) 224, 408
BspCNI CTCAG 3 cut(s) 28, 157, 196
BspHI TCATGA 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 190
BspPI GGATC 2 cut(s) 106, 132
BspQI GCTCTTC 1 cut(s) 249
BspT107I GGYRCC 1 cut(s) 188
BsrI ACTGG 1 cut(s) 312
BssMI GATC 5 cut(s) 25, 30, 111, 124, 441
Bst4CI ACNGT 3 cut(s) 80, 91, 109
Bst6I CTCTTC 2 cut(s) 65, 249
BstDEI CTNAG 3 cut(s) 36, 165, 204
BstF5I GGATG 1 cut(s) 403
BstKTI GATC 5 cut(s) 28, 33, 114, 127, 444
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 5 cut(s) 25, 30, 111, 124, 441
BsuI GTATCC 1 cut(s) 293
BsuRI GGCC 2 cut(s) 224, 408
BtsCI GGATG 1 cut(s) 403
BtsIMutI CAGTG 5 cut(s) 14, 33, 114, 162, 319
CciI TCATGA 1 cut(s) 151
CviAII CATG 3 cut(s) 152, 220, 326
CviJI RGCY 5 cut(s) 50, 224, 259, 352, 408
CviKI_1 RGCY 5 cut(s) 50, 224, 259, 352, 408
DdeI CTNAG 3 cut(s) 36, 165, 204
DpnI GATC 5 cut(s) 27, 32, 113, 126, 443
DpnII GATC 5 cut(s) 25, 30, 111, 124, 441
EaeI YGGCCR 2 cut(s) 222, 406
Eam1104I CTCTTC 2 cut(s) 65, 249
EarI CTCTTC 2 cut(s) 65, 249
Eco32I GATATC 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 218
EcoRV GATATC 1 cut(s) 157
FaeI CATG 3 cut(s) 155, 223, 329
FaiI YATR 5 cut(s) 86, 153, 221, 327, 420
FatI CATG 3 cut(s) 151, 219, 325
FbaI TGATCA 1 cut(s) 441
FokI GGATG 1 cut(s) 410
FspBI CTAG 1 cut(s) 341
HaeIII GGCC 2 cut(s) 224, 408
Hin1II CATG 3 cut(s) 155, 223, 329
HinfI GANTC 3 cut(s) 130, 173, 322
HphI GGTGA 1 cut(s) 413
Hpy188I TCNGA 4 cut(s) 30, 129, 135, 178
Hpy188III TCNNGA 3 cut(s) 152, 236, 433
Hpy99I CGWCG 1 cut(s) 80
HpyCH4III ACNGT 3 cut(s) 80, 91, 109
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 3 cut(s) 36, 165, 204
Hsp92II CATG 3 cut(s) 155, 223, 329
Ksp22I TGATCA 1 cut(s) 441
Kzo9I GATC 5 cut(s) 25, 30, 111, 124, 441
LguI GCTCTTC 1 cut(s) 249
LpnPI CCDG 2 cut(s) 221, 325
LweI GCATC 1 cut(s) 235
MaeI CTAG 1 cut(s) 341
MalI GATC 5 cut(s) 27, 32, 113, 126, 443
MboI GATC 5 cut(s) 25, 30, 111, 124, 441
MboII GAAGA 5 cut(s) 17, 52, 107, 266, 374
MlsI TGGCCA 2 cut(s) 224, 408
MluCI AATT 3 cut(s) 197, 415, 425
MluNI TGGCCA 2 cut(s) 224, 408
MlyI GAGTC 1 cut(s) 331
MmeI TCCRAC 2 cut(s) 102, 158
MnlI CCTC 3 cut(s) 227, 244, 379
Mox20I TGGCCA 2 cut(s) 224, 408
MscI TGGCCA 2 cut(s) 224, 408
Msp20I TGGCCA 2 cut(s) 224, 408
Mva1269I GAATGC 1 cut(s) 269
NdeII GATC 5 cut(s) 25, 30, 111, 124, 441
NlaIII CATG 3 cut(s) 155, 223, 329
NlaIV GGNNCC 1 cut(s) 190
PagI TCATGA 1 cut(s) 151
PciSI GCTCTTC 1 cut(s) 249
PctI GAATGC 1 cut(s) 269
PfeI GAWTC 2 cut(s) 130, 173
PleI GAGTC 1 cut(s) 330
PpsI GAGTC 1 cut(s) 330
PspN4I GGNNCC 1 cut(s) 190
SapI GCTCTTC 1 cut(s) 249
Sau3AI GATC 5 cut(s) 25, 30, 111, 124, 441
SchI GAGTC 1 cut(s) 331
SetI ASST 3 cut(s) 219, 261, 354
SfaNI GCATC 1 cut(s) 235
Sse9I AATT 3 cut(s) 197, 415, 425
SsiI CCGC 1 cut(s) 248
SspMI CTAG 1 cut(s) 341
TaaI ACNGT 3 cut(s) 80, 91, 109
TaqI TCGA 1 cut(s) 63
TasI AATT 3 cut(s) 197, 415, 425
TfiI GAWTC 2 cut(s) 130, 173
TscAI CASTG 5 cut(s) 21, 40, 114, 169, 319
TspDTI ATGAA 3 cut(s) 140, 375, 438
TspGWI ACGGA 1 cut(s) 104
TspRI CASTG 5 cut(s) 21, 40, 114, 169, 319
XapI RAATTY 2 cut(s) 197, 425
XspI CTAG 1 cut(s) 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.