AT5G42300

Ubiquitin-like protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
16911579 .. 16913991
2413 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G42300.1

Sequence Viewer

Length: 222 bp
ATGATCGAGGTGGTTCTCAACGATCGTTTAGGGAAAAAAGTTAGGGTGAAGTGTAACGATGATGACACGATCGGTGATCTGAAGAAGCTTGTCGCGGCACAAACCGGAACACGAGCCGAGAAGATCAGAATTCAGAAGTGGTACAACATCTACAAGGATCACATCACTCTCAAGGACTATGAGATCCATGACGGCATGGGTCTTGAGCTTTACTACAACTAG

Protein Analysis

73

Amino Acids

8.57

Weight (kDa)

7.83

Isoelectric Point (pI)

20.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 11 - 71 1.4e-06 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 95
AciI CCGC 1 cut(s) 95
AclWI GGATC 2 cut(s) 165, 178
AcsI RAATTY 1 cut(s) 129
AcuI CTGAAG 1 cut(s) 101
AfaI GTAC 1 cut(s) 143
AluBI AGCT 2 cut(s) 88, 208
AluI AGCT 2 cut(s) 88, 208
AlwI GGATC 2 cut(s) 165, 178
ApoI RAATTY 1 cut(s) 129
AsuHPI GGTGA 2 cut(s) 58, 86
BauI CACGAG 1 cut(s) 111
BceAI ACGGC 1 cut(s) 208
BfaI CTAG 1 cut(s) 220
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
BpuEI CTTGAG 1 cut(s) 155
BsaWI WCCGGW 1 cut(s) 104
Bsh1236I CGCG 1 cut(s) 95
Bsh1285I CGRYCG 2 cut(s) 25, 72
BsiEI CGRYCG 2 cut(s) 25, 72
BsiSI CCGG 1 cut(s) 105
Bsp143I GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
BspACI CCGC 1 cut(s) 95
BspFNI CGCG 1 cut(s) 95
BspPI GGATC 2 cut(s) 165, 178
BssMI GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
BssSI CACGAG 1 cut(s) 111
Bst2BI CACGAG 1 cut(s) 111
BstFNI CGCG 1 cut(s) 95
BstKTI GATC 7 cut(s) 6, 25, 72, 79, 126, 160, 186
BstMBI GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
BstMCI CGRYCG 2 cut(s) 25, 72
BstUI CGCG 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 183
BstYI RGATCY 1 cut(s) 183
Csp6I GTAC 1 cut(s) 142
CviAII CATG 2 cut(s) 188, 196
CviJI RGCY 3 cut(s) 88, 116, 208
CviKI_1 RGCY 3 cut(s) 88, 116, 208
CviQI GTAC 1 cut(s) 142
DpnI GATC 7 cut(s) 5, 24, 71, 78, 125, 159, 185
DpnII GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
Eco57I CTGAAG 1 cut(s) 101
EcoRI GAATTC 1 cut(s) 129
FaeI CATG 2 cut(s) 191, 199
FaiI YATR 3 cut(s) 180, 189, 197
FatI CATG 2 cut(s) 187, 195
Fnu4HI GCNGC 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 96
FspBI CTAG 1 cut(s) 220
GluI GCNGC 1 cut(s) 96
HapII CCGG 1 cut(s) 105
Hin1II CATG 2 cut(s) 191, 199
HindIII AAGCTT 1 cut(s) 86
HpaII CCGG 1 cut(s) 105
HphI GGTGA 2 cut(s) 58, 86
Hpy188I TCNGA 3 cut(s) 81, 128, 135
Hpy188III TCNNGA 1 cut(s) 203
Hsp92II CATG 2 cut(s) 191, 199
Kzo9I GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
LpnPI CCDG 1 cut(s) 118
MaeI CTAG 1 cut(s) 220
MaeIII GTNAC 1 cut(s) 53
MalI GATC 7 cut(s) 5, 24, 71, 78, 125, 159, 185
MboI GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
MboII GAAGA 2 cut(s) 94, 133
MflI RGATCY 1 cut(s) 183
MluCI AATT 1 cut(s) 129
MspI CCGG 1 cut(s) 105
MvnI CGCG 1 cut(s) 95
NdeII GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
NlaIII CATG 2 cut(s) 191, 199
NmeAIII GCCGAG 1 cut(s) 142
PkrI GCNGC 1 cut(s) 97
Ple19I CGATCG 2 cut(s) 25, 72
PsuI RGATCY 1 cut(s) 183
PvuI CGATCG 2 cut(s) 25, 72
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 7 cut(s) 3, 22, 69, 76, 123, 157, 183
SetI ASST 3 cut(s) 12, 90, 210
SmlI CTYRAG 2 cut(s) 170, 203
SmoI CTYRAG 2 cut(s) 170, 203
Sse9I AATT 1 cut(s) 129
SsiI CCGC 1 cut(s) 95
SspMI CTAG 1 cut(s) 220
TaqI TCGA 1 cut(s) 6
TasI AATT 1 cut(s) 129
TauI GCSGC 1 cut(s) 98
XapI RAATTY 1 cut(s) 129
XspI CTAG 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.