AT5G65040

zinc-finger of the FCS-type, C2-C2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0017533
Physical Location & Seq
Reverse (-)
25977495 .. 25978439
945 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G65040.1

Sequence Viewer

Length: 342 bp
ATGGTGTTAGGAAAGCGTCATGGATCACTGATCAAGAGAACAACTAGCATGAAGATGATCACACTCGATACACCCACGATCTATGACGCATCTCAGCCGTCCGATCATCTAACCTTTCATCAACACCCTCACAATCCGATGGTGGTGATGGCTAGTAACTACGATGATTTCTTGAAGACTTGTAGTCTCTGCAATCGAAGTCTCTGCCATCATCGTGACATTTACATGTATAGAGGGAACAACGCATTTTGTAGCTTAGAATGCAGGGAGAAGCAAATTAAGCTGGACGAGAAAAAAGCGAAAACCGGCTTCGTAACATCGAAGAAACCAATTCGTATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-FLZ

Protein Analysis

113

Amino Acids

13.07

Weight (kDa)

9.45

Isoelectric Point (pI)

39.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-FLZ PF04570 54 - 99 9.9e-22 zinc-finger of the FCS-type, C2-C2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017533)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G39795 AT5G65040
fragaria_vesca FvH4_3g43200
rosa_laevigata RLG00000036674
rosa_multiflora Rmu_sc0005576.1_g000012
rosa_roxburghii Rroxscaffold_1G00004810
rosa_rugosa Rorug05G0452800.1
rosa_samantha Rh5AG507800 Rh5BG529300 Rh5CG553700 Rh5DG541500
rosa_wichuraiana Rw5G046960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 31
AflIII ACRYGT 1 cut(s) 225
AgsI TTSAA 1 cut(s) 175
AhdI GACNNNNNGTC 1 cut(s) 183
AluBI AGCT 2 cut(s) 255, 283
AluI AGCT 2 cut(s) 255, 283
Alw26I GTCTC 2 cut(s) 191, 206
AlwI GGATC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 182
BccI CCATC 3 cut(s) 133, 142, 216
BceAI ACGGC 1 cut(s) 82
BcgI CGANNNNNNTGC 2 cut(s) 186, 220
BclI TGATCA 2 cut(s) 30, 57
BcoDI GTCTC 2 cut(s) 191, 206
BfaI CTAG 2 cut(s) 45, 153
BmeRI GACNNNNNGTC 1 cut(s) 183
BmsI GCATC 1 cut(s) 98
BpiI GAAGAC 1 cut(s) 182
Bse118I RCCGGY 1 cut(s) 305
BseMII CTCAG 1 cut(s) 107
BsiSI CCGG 1 cut(s) 306
BsmAI GTCTC 2 cut(s) 191, 206
BsmI GAATGC 1 cut(s) 266
Bsp143I GATC 5 cut(s) 23, 30, 57, 78, 103
BspCNI CTCAG 1 cut(s) 106
BspPI GGATC 1 cut(s) 31
BsrFI RCCGGY 1 cut(s) 305
BssAI RCCGGY 1 cut(s) 305
BssMI GATC 5 cut(s) 23, 30, 57, 78, 103
BstDEI CTNAG 2 cut(s) 93, 256
BstKTI GATC 5 cut(s) 26, 33, 60, 81, 106
BstMAI GTCTC 2 cut(s) 191, 206
BstMBI GATC 5 cut(s) 23, 30, 57, 78, 103
BstMWI GCNNNNNNNGC 2 cut(s) 261, 280
BstNSI RCATGY 1 cut(s) 229
BstV2I GAAGAC 1 cut(s) 182
BtsIMutI CAGTG 1 cut(s) 26
Cfr10I RCCGGY 1 cut(s) 305
CseI GACGC 2 cut(s) 5, 95
CviAII CATG 3 cut(s) 20, 49, 226
CviJI RGCY 5 cut(s) 97, 152, 255, 283, 309
CviKI_1 RGCY 5 cut(s) 97, 152, 255, 283, 309
DdeI CTNAG 2 cut(s) 93, 256
DpnI GATC 5 cut(s) 25, 32, 59, 80, 105
DpnII GATC 5 cut(s) 23, 30, 57, 78, 103
DriI GACNNNNNGTC 1 cut(s) 183
Eam1105I GACNNNNNGTC 1 cut(s) 183
FaeI CATG 3 cut(s) 23, 52, 229
FaiI YATR 5 cut(s) 21, 50, 84, 227, 231
FatI CATG 3 cut(s) 19, 48, 225
FbaI TGATCA 2 cut(s) 30, 57
FspBI CTAG 2 cut(s) 45, 153
HapII CCGG 1 cut(s) 306
HgaI GACGC 2 cut(s) 5, 95
Hin1II CATG 3 cut(s) 23, 52, 229
HpaII CCGG 1 cut(s) 306
HphI GGTGA 1 cut(s) 157
Hpy188I TCNGA 2 cut(s) 103, 138
Hpy188III TCNNGA 3 cut(s) 34, 172, 215
HpyCH4V TGCA 2 cut(s) 192, 264
HpyF10VI GCNNNNNNNGC 2 cut(s) 261, 280
HpyF3I CTNAG 2 cut(s) 93, 256
Hsp92II CATG 3 cut(s) 23, 52, 229
Ksp22I TGATCA 2 cut(s) 30, 57
Kzo9I GATC 5 cut(s) 23, 30, 57, 78, 103
LpnPI CCDG 3 cut(s) 250, 269, 319
LweI GCATC 1 cut(s) 98
MaeI CTAG 2 cut(s) 45, 153
MaeIII GTNAC 3 cut(s) 155, 215, 313
MalI GATC 5 cut(s) 25, 32, 59, 80, 105
MboI GATC 5 cut(s) 23, 30, 57, 78, 103
MboII GAAGA 3 cut(s) 64, 187, 334
MluCI AATT 2 cut(s) 276, 330
MnlI CCTC 2 cut(s) 138, 227
MseI TTAA 1 cut(s) 279
MslI CAYNNNNRTG 3 cut(s) 53, 213, 224
MspI CCGG 1 cut(s) 306
Mva1269I GAATGC 1 cut(s) 266
MwoI GCNNNNNNNGC 2 cut(s) 261, 280
NdeII GATC 5 cut(s) 23, 30, 57, 78, 103
NlaIII CATG 3 cut(s) 23, 52, 229
NmuCI GTSAC 1 cut(s) 215
NspI RCATGY 1 cut(s) 229
PciI ACATGT 1 cut(s) 225
PctI GAATGC 1 cut(s) 266
PscI ACATGT 1 cut(s) 225
RseI CAYNNNNRTG 3 cut(s) 53, 213, 224
SaqAI TTAA 1 cut(s) 279
Sau3AI GATC 5 cut(s) 23, 30, 57, 78, 103
SetI ASST 3 cut(s) 116, 257, 285
SfaNI GCATC 1 cut(s) 98
SmiMI CAYNNNNRTG 3 cut(s) 53, 213, 224
Sse9I AATT 2 cut(s) 276, 330
SspMI CTAG 2 cut(s) 45, 153
TaqI TCGA 3 cut(s) 66, 196, 320
TasI AATT 2 cut(s) 276, 330
Tru1I TTAA 1 cut(s) 279
Tru9I TTAA 1 cut(s) 279
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 215
Tsp45I GTSAC 1 cut(s) 215
TspDTI ATGAA 2 cut(s) 65, 107
TspRI CASTG 1 cut(s) 33
XceI RCATGY 1 cut(s) 229
XspI CTAG 2 cut(s) 45, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.