ATCG00360

Essential for the assembly of the photosystem I (PSI) complex. May act as a chaperone-like factor to guide the assembly of the PSI subunits

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
Physical Location & Seq
Reverse (-)
42584 .. 43751
1168 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00360.1

Sequence Viewer

Length: 381 bp
ATGTCGGCTCAATCTGAAGGAAATTATGCGGAAGCATTACAGAATTATTATGAAGCTATGCGACTAGAAATTGACCCCTATGATCGAAGTTATATACTCTATAATATAGGCCTTATCCATACAAGTAATGGGGAACATACCAAAGCTTTAGAATATTATTTTCGGGCATTAGAACGAAACCCCTTTTTACCACAAGCTTTTAATAATATGGCTGTGATCTGTCATTACCGTGGAGAACAGGCCATTCAACAAGGAGATTCTGAAATGGCGGAGGCTTGGTTCGCTCAAGCCGCTGAGTATTGGAAACAGGCTATAACGCTTACTCCTGGTAATTATATTGAAGCACAGAATTGGTTGACGATCACGAGGCGCTTCGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.75

Weight (kDa)

4.89

Isoelectric Point (pI)

57.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_16 PF13432 3 - 63 8.2e-06 Tetratricopeptide repeat
TPR_12 PF13424 3 - 59 5.7e-06 Tetratricopeptide repeat
TPR_1 PF00515 31 - 61 3.6e-09 Tetratricopeptide repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022111)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00360
prunus_persica Prupe.1G271000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0077061 RchiOBHm_Chr5g0077071

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 29, 269, 291
AcuI CTGAAG 1 cut(s) 36
AgsI TTSAA 2 cut(s) 248, 341
AjnI CCWGG 1 cut(s) 325
AloI GAACNNNNNNTCC 2 cut(s) 263, 295
AluBI AGCT 3 cut(s) 56, 146, 197
AluI AGCT 3 cut(s) 56, 146, 197
AoxI GGCC 2 cut(s) 109, 240
AspLEI GCGC 1 cut(s) 372
AsuII TTCGAA 1 cut(s) 375
BauI CACGAG 1 cut(s) 364
BciT130I CCWGG 1 cut(s) 327
BfaI CTAG 1 cut(s) 65
BfoI RGCGCY 1 cut(s) 373
BisI GCNGC 1 cut(s) 291
BlsI GCNGC 1 cut(s) 292
Bme1390I CCNGG 1 cut(s) 327
BmrFI CCNGG 1 cut(s) 327
Bpu14I TTCGAA 1 cut(s) 375
BpuEI CTTGAG 1 cut(s) 270
BsaJI CCNNGG 1 cut(s) 229
BsaXI ACNNNNNCTCC 4 cut(s) 263, 293, 307, 337
BseBI CCWGG 1 cut(s) 327
BseDI CCNNGG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 285
BshFI GGCC 2 cut(s) 111, 242
BsnI GGCC 2 cut(s) 111, 242
Bsp119I TTCGAA 1 cut(s) 375
Bsp143I GATC 3 cut(s) 82, 216, 360
BspACI CCGC 3 cut(s) 29, 269, 291
BspANI GGCC 2 cut(s) 111, 242
BspCNI CTCAG 1 cut(s) 286
BspT104I TTCGAA 1 cut(s) 375
BssECI CCNNGG 1 cut(s) 229
BssMI GATC 3 cut(s) 82, 216, 360
BssSI CACGAG 1 cut(s) 364
Bst2BI CACGAG 1 cut(s) 364
Bst2UI CCWGG 1 cut(s) 327
Bst4CI ACNGT 1 cut(s) 230
BstBI TTCGAA 1 cut(s) 375
BstDEI CTNAG 1 cut(s) 294
BstDSI CCRYGG 1 cut(s) 229
BstH2I RGCGCY 1 cut(s) 373
BstHHI GCGC 1 cut(s) 372
BstKTI GATC 3 cut(s) 85, 219, 363
BstMBI GATC 3 cut(s) 82, 216, 360
BstMWI GCNNNNNNNGC 2 cut(s) 281, 290
BstNI CCWGG 1 cut(s) 327
BstSCI CCNGG 1 cut(s) 325
BsuRI GGCC 2 cut(s) 111, 242
BtgI CCRYGG 1 cut(s) 229
CfoI GCGC 1 cut(s) 372
DdeI CTNAG 1 cut(s) 294
DpnI GATC 3 cut(s) 84, 218, 362
DpnII GATC 3 cut(s) 82, 216, 360
EciI GGCGGA 1 cut(s) 284
Eco147I AGGCCT 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 325
Fnu4HI GCNGC 1 cut(s) 291
Fsp4HI GCNGC 1 cut(s) 291
FspBI CTAG 1 cut(s) 65
GlaI GCGC 1 cut(s) 371
GluI GCNGC 1 cut(s) 291
HaeII RGCGCY 1 cut(s) 373
HaeIII GGCC 2 cut(s) 111, 242
HhaI GCGC 1 cut(s) 372
Hin6I GCGC 1 cut(s) 370
HinP1I GCGC 1 cut(s) 370
HincII GTYRAC 1 cut(s) 357
HindII GTYRAC 1 cut(s) 357
HindIII AAGCTT 2 cut(s) 144, 195
HinfI GANTC 1 cut(s) 257
Hpy166II GTNNAC 1 cut(s) 357
Hpy188I TCNGA 2 cut(s) 16, 262
Hpy188III TCNNGA 1 cut(s) 364
Hpy8I GTNNAC 1 cut(s) 357
HpyAV CCTTC 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 230
HpyF10VI GCNNNNNNNGC 2 cut(s) 281, 290
HpyF3I CTNAG 1 cut(s) 294
HspAI GCGC 1 cut(s) 370
Kzo9I GATC 3 cut(s) 82, 216, 360
LpnPI CCDG 4 cut(s) 224, 293, 312, 339
MaeI CTAG 1 cut(s) 65
MalI GATC 3 cut(s) 84, 218, 362
MboI GATC 3 cut(s) 82, 216, 360
MluCI AATT 5 cut(s) 22, 43, 69, 331, 349
MnlI CCTC 2 cut(s) 265, 360
MseI TTAA 1 cut(s) 201
MslI CAYNNNNRTG 1 cut(s) 228
MspA1I CMGCKG 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 327
MvaI CCWGG 1 cut(s) 327
MwoI GCNNNNNNNGC 2 cut(s) 281, 290
NdeII GATC 3 cut(s) 82, 216, 360
NspV TTCGAA 1 cut(s) 375
PceI AGGCCT 1 cut(s) 111
PfeI GAWTC 1 cut(s) 257
PkrI GCNGC 1 cut(s) 292
Psp6I CCWGG 1 cut(s) 325
PspGI CCWGG 1 cut(s) 325
RseI CAYNNNNRTG 1 cut(s) 228
SaqAI TTAA 1 cut(s) 201
SatI GCNGC 1 cut(s) 291
Sau3AI GATC 3 cut(s) 82, 216, 360
ScrFI CCNGG 1 cut(s) 327
SetI ASST 3 cut(s) 58, 148, 199
SfuI TTCGAA 1 cut(s) 375
SmiMI CAYNNNNRTG 1 cut(s) 228
SmlI CTYRAG 1 cut(s) 285
SmoI CTYRAG 1 cut(s) 285
Sse9I AATT 5 cut(s) 22, 43, 69, 331, 349
SseBI AGGCCT 1 cut(s) 111
SsiI CCGC 3 cut(s) 29, 269, 291
SspI AATATT 1 cut(s) 155
SspMI CTAG 1 cut(s) 65
StuI AGGCCT 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 325
TaaI ACNGT 1 cut(s) 230
TaqI TCGA 2 cut(s) 85, 375
TasI AATT 5 cut(s) 22, 43, 69, 331, 349
TauI GCSGC 1 cut(s) 293
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TspDTI ATGAA 1 cut(s) 66
XcmI CCANNNNNNNNNTGG 1 cut(s) 125
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.