RchiOBHm_Chr5g0077061

Essential for the assembly of the photosystem I (PSI) complex. May act as a chaperone-like factor to guide the assembly of the PSI subunits

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
82837245 .. 82837415
171 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35167

Sequence Viewer

Length: 171 bp
ATGTCGGCTCAATCCGAAGGAAATTATTGGGAAGCTTTAAAAAATTATTATGGAGCTATGCGACAGGAAATTGGTCCTTATGATCGAAGTTATATACTCTATAACATAGGTCGTATCCATACAATGAACGAAGAACATACAAAACCTTTAGAATATTATTTCGGGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.74

Weight (kDa)

5.81

Isoelectric Point (pI)

59.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022111)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00360
prunus_persica Prupe.1G271000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0077061 RchiOBHm_Chr5g0077071

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 35, 56
AluI AGCT 2 cut(s) 35, 56
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BaeGI GKGCMC 1 cut(s) 168
BciVI GTATCC 1 cut(s) 125
BfaI CTAG 1 cut(s) 169
BfuI GTATCC 1 cut(s) 125
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BseSI GKGCMC 1 cut(s) 168
Bsp1286I GDGCHC 1 cut(s) 168
Bsp143I GATC 1 cut(s) 82
BssMI GATC 1 cut(s) 82
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstSLI GKGCMC 1 cut(s) 168
BsuI GTATCC 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 74
CviJI RGCY 3 cut(s) 8, 35, 56
CviKI_1 RGCY 3 cut(s) 8, 35, 56
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
DraI TTTAAA 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 74
FaiI YATR 9 cut(s) 51, 59, 81, 93, 95, 102, 107, 120, 138
FspBI CTAG 1 cut(s) 169
HindIII AAGCTT 1 cut(s) 33
Hpy188I TCNGA 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 11
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 50
MaeI CTAG 1 cut(s) 169
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 143
MhlI GDGCHC 1 cut(s) 168
MluCI AATT 3 cut(s) 22, 43, 69
MseI TTAA 1 cut(s) 38
NdeII GATC 1 cut(s) 82
PspPI GGNCC 1 cut(s) 74
SaqAI TTAA 1 cut(s) 38
Sau3AI GATC 1 cut(s) 82
Sau96I GGNCC 1 cut(s) 74
SduI GDGCHC 1 cut(s) 168
SetI ASST 4 cut(s) 37, 58, 112, 148
SgeI CNNG 1 cut(s) 77
SinI GGWCC 1 cut(s) 74
Sse9I AATT 3 cut(s) 22, 43, 69
SspI AATATT 1 cut(s) 155
SspMI CTAG 1 cut(s) 169
TaqI TCGA 1 cut(s) 85
TasI AATT 3 cut(s) 22, 43, 69
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 140
VpaK11BI GGWCC 1 cut(s) 74
XspI CTAG 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.