Prupe.1G271000_v2.0.a1

Photosystem I assembly protein Ycf3

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
27808000 .. 27809070
1071 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G271000.1

Sequence Viewer

Length: 249 bp
ATGTCGGCTCAATCCGAAGGAAATTATGCGGAAGCTTTACAGAATTATTATGAAGCTATGCGACTAGAAATTGATCCTTATGATCGAAGTTATATACTCTATAACATAGGCCTTATCCACACAAGTAACGGGGAACATACGAAAGCTTTGGAATATTATTTTCGGGCCCTAGAGCGAAACCCATTCTTACCACAAGCTTTTAATAATATGGCCGTGATCTGTCATTACGTGCGACTATCTCCACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.61

Weight (kDa)

5.45

Isoelectric Point (pI)

67.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022111)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00360
prunus_persica Prupe.1G271000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0077061 RchiOBHm_Chr5g0077071

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AclWI GGATC 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 210
AluBI AGCT 4 cut(s) 35, 56, 146, 197
AluI AGCT 4 cut(s) 35, 56, 146, 197
AlwI GGATC 1 cut(s) 68
AoxI GGCC 3 cut(s) 109, 165, 210
ApaI GGGCCC 1 cut(s) 169
AspS9I GGNCC 2 cut(s) 165, 166
BaeGI GKGCMC 1 cut(s) 169
BanII GRGCYC 1 cut(s) 169
BceAI ACGGC 1 cut(s) 197
BfaI CTAG 2 cut(s) 65, 170
BfmI CTRYAG 1 cut(s) 245
BmgT120I GGNCC 2 cut(s) 165, 166
BmiI GGNNCC 1 cut(s) 167
BsaAI YACGTR 1 cut(s) 229
BseSI GKGCMC 1 cut(s) 169
BshFI GGCC 3 cut(s) 111, 167, 212
BsnI GGCC 3 cut(s) 111, 167, 212
Bsp120I GGGCCC 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 169
Bsp143I GATC 3 cut(s) 73, 82, 216
BspACI CCGC 1 cut(s) 29
BspANI GGCC 3 cut(s) 111, 167, 212
BspLI GGNNCC 1 cut(s) 167
BspPI GGATC 1 cut(s) 68
BssMI GATC 3 cut(s) 73, 82, 216
BstBAI YACGTR 1 cut(s) 229
BstKTI GATC 3 cut(s) 76, 85, 219
BstMBI GATC 3 cut(s) 73, 82, 216
BstSFI CTRYAG 1 cut(s) 245
BstSLI GKGCMC 1 cut(s) 169
BsuRI GGCC 3 cut(s) 111, 167, 212
Cfr13I GGNCC 2 cut(s) 165, 166
CviJI RGCY 8 cut(s) 8, 35, 56, 111, 146, 167, 197, 212
CviKI_1 RGCY 8 cut(s) 8, 35, 56, 111, 146, 167, 197, 212
DpnI GATC 3 cut(s) 75, 84, 218
DpnII GATC 3 cut(s) 73, 82, 216
EaeI YGGCCR 1 cut(s) 210
Eco147I AGGCCT 1 cut(s) 111
Eco24I GRGCYC 1 cut(s) 169
EcoO109I RGGNCCY 1 cut(s) 166
EcoT38I GRGCYC 1 cut(s) 169
FriOI GRGCYC 1 cut(s) 169
FspBI CTAG 2 cut(s) 65, 170
HaeIII GGCC 3 cut(s) 111, 167, 212
HindIII AAGCTT 3 cut(s) 33, 144, 195
Hpy188I TCNGA 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 228
HpySE526I ACGT 1 cut(s) 228
Kzo9I GATC 3 cut(s) 73, 82, 216
MaeI CTAG 2 cut(s) 65, 170
MaeII ACGT 1 cut(s) 228
MaeIII GTNAC 1 cut(s) 125
MalI GATC 3 cut(s) 75, 84, 218
MboI GATC 3 cut(s) 73, 82, 216
MhlI GDGCHC 1 cut(s) 169
MluCI AATT 3 cut(s) 22, 43, 69
MseI TTAA 1 cut(s) 201
NdeII GATC 3 cut(s) 73, 82, 216
NlaIV GGNNCC 1 cut(s) 167
PceI AGGCCT 1 cut(s) 111
Ppu21I YACGTR 1 cut(s) 229
PspN4I GGNNCC 1 cut(s) 167
PspOMI GGGCCC 1 cut(s) 165
PspPI GGNCC 2 cut(s) 165, 166
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 3 cut(s) 73, 82, 216
Sau96I GGNCC 2 cut(s) 165, 166
SduI GDGCHC 1 cut(s) 169
SetI ASST 5 cut(s) 37, 58, 148, 199, 231
SfcI CTRYAG 1 cut(s) 245
SgeI CNNG 8 cut(s) 77, 135, 142, 176, 182, 206, 226, 241
Sse9I AATT 3 cut(s) 22, 43, 69
SseBI AGGCCT 1 cut(s) 111
SsiI CCGC 1 cut(s) 29
SspI AATATT 1 cut(s) 155
SspMI CTAG 2 cut(s) 65, 170
StuI AGGCCT 1 cut(s) 111
TaiI ACGT 1 cut(s) 231
TaqI TCGA 1 cut(s) 85
TasI AATT 3 cut(s) 22, 43, 69
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TspDTI ATGAA 1 cut(s) 66
XspI CTAG 2 cut(s) 65, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.