RchiOBHm_Chr5g0077071

Essential for the assembly of the photosystem I (PSI) complex. May act as a chaperone-like factor to guide the assembly of the PSI subunits

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
82838611 .. 82838817
207 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35168

Sequence Viewer

Length: 207 bp
ATGTCGGCTCAATCCGAAGGAAATTATGCGGAGGCTTTAAAAAATTATTATGGAGCTATGCAACTAGAAATTGGTCCTTATGATCGAAGTTATATACTCTATAACATAGGTCGTATCCATACAAGGAACGGAGAACGTACATACAAAAGCTTTAGAATATTATTTCAGGCACTAGAACGAAACCCCATTCTTACCACAAGCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.94

Weight (kDa)

9.1

Isoelectric Point (pI)

52.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022111)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00360
prunus_persica Prupe.1G271000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0077061 RchiOBHm_Chr5g0077071

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AfaI GTAC 1 cut(s) 139
AluBI AGCT 3 cut(s) 56, 150, 201
AluI AGCT 3 cut(s) 56, 150, 201
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BciVI GTATCC 1 cut(s) 125
BfaI CTAG 2 cut(s) 65, 173
BfuI GTATCC 1 cut(s) 125
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 82
BspACI CCGC 1 cut(s) 29
BssMI GATC 1 cut(s) 82
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BsuI GTATCC 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 5 cut(s) 8, 35, 56, 150, 201
CviKI_1 RGCY 5 cut(s) 8, 35, 56, 150, 201
CviQI GTAC 1 cut(s) 138
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
DraI TTTAAA 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 74
FspBI CTAG 2 cut(s) 65, 173
HindIII AAGCTT 2 cut(s) 148, 199
Hpy188I TCNGA 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 136
HpyCH4V TGCA 1 cut(s) 61
HpySE526I ACGT 1 cut(s) 136
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 152
MaeI CTAG 2 cut(s) 65, 173
MaeII ACGT 1 cut(s) 136
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MluCI AATT 3 cut(s) 22, 43, 69
MnlI CCTC 1 cut(s) 25
MseI TTAA 2 cut(s) 38, 205
NdeII GATC 1 cut(s) 82
PspPI GGNCC 1 cut(s) 74
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 38, 205
Sau3AI GATC 1 cut(s) 82
Sau96I GGNCC 1 cut(s) 74
SetI ASST 5 cut(s) 58, 112, 139, 152, 203
SgeI CNNG 4 cut(s) 77, 135, 179, 185
SinI GGWCC 1 cut(s) 74
Sse9I AATT 3 cut(s) 22, 43, 69
SsiI CCGC 1 cut(s) 29
SspI AATATT 1 cut(s) 159
SspMI CTAG 2 cut(s) 65, 173
TaiI ACGT 1 cut(s) 139
TaqI TCGA 1 cut(s) 85
TasI AATT 3 cut(s) 22, 43, 69
Tru1I TTAA 2 cut(s) 38, 205
Tru9I TTAA 2 cut(s) 38, 205
TspGWI ACGGA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 74
XspI CTAG 2 cut(s) 65, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.