ATCG00420

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
Physical Location & Seq
Reverse (-)
48677 .. 49153
477 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00420.1

Sequence Viewer

Length: 477 bp
ATGCAGGGCACTTTGTCCGTTTGGCTAGCCAAACGCGGGCTGGTTCATAGATCGTTGGGCTTCGATTATCAAGGAATAGAGACTTTACAAATAAAGCCCGAAGATTGGCATTCTATTGCTGTAATTTTATATGTATATGGTTACAATTATTTACGTTCGCAATGTGCCTATGATGTGGCACCAGGTGGCCTCTTAGCCAGCGTGTATCATCTTACGAGAATAGAATATGGTGTTAATCAAGCGGAAGAAGTCTGCATAAAAGTATTTACTCACAGGAGTAATCCTAGAATTCCATCCGTTTTCTGGGTTTGGAAAAGTACGGATTTTCAAGAACGGGAATCTTATGATATGTTAGGAATCACTTATGATAGCCATCCACGACTGAAACGGATCCTAATGCCCGAGAGTTGGATAGGGTGGCCTTTACGTAAGGATTATATTGCCCCCAATTTTTATGAAATACAAGATGCTTATTGA

Protein Analysis

158

Amino Acids

18.56

Weight (kDa)

6.51

Isoelectric Point (pI)

54.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Complex1_30kDa PF00329 30 - 148 9.4e-34 Respiratory-chain NADH dehydrogenase, 30 Kd subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 178
AccII CGCG 1 cut(s) 36
AciI CCGC 2 cut(s) 36, 242
AclWI GGATC 2 cut(s) 385, 398
AcsI RAATTY 1 cut(s) 288
AdeI CACNNNGTG 1 cut(s) 185
AfaI GTAC 1 cut(s) 319
AfiI CCNNNNNNNGG 4 cut(s) 36, 105, 303, 408
AgsI TTSAA 1 cut(s) 329
AjnI CCWGG 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 2 cut(s) 385, 398
Ama87I CYCGRG 1 cut(s) 401
AoxI GGCC 2 cut(s) 187, 419
ApoI RAATTY 1 cut(s) 288
AsuNHI GCTAGC 1 cut(s) 25
AvaI CYCGRG 1 cut(s) 401
BaeGI GKGCMC 1 cut(s) 11
BamHI GGATCC 1 cut(s) 390
BanI GGYRCC 1 cut(s) 178
BccI CCATC 2 cut(s) 301, 381
BciT130I CCWGG 1 cut(s) 183
BcoDI GTCTC 1 cut(s) 74
BfaI CTAG 2 cut(s) 26, 285
Bme1390I CCNGG 1 cut(s) 183
BmeT110I CYCGRG 1 cut(s) 401
BmiI GGNNCC 2 cut(s) 180, 392
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 1 cut(s) 457
BmtI GCTAGC 1 cut(s) 29
BsaAI YACGTR 1 cut(s) 428
BsaBI GATNNNNATC 1 cut(s) 372
Bsc4I CCNNNNNNNGG 4 cut(s) 36, 105, 303, 408
Bse3DI GCAATG 1 cut(s) 167
Bse8I GATNNNNATC 1 cut(s) 372
BseBI CCWGG 1 cut(s) 183
BseGI GGATG 2 cut(s) 293, 373
BseJI GATNNNNATC 1 cut(s) 372
BseLI CCNNNNNNNGG 4 cut(s) 36, 105, 303, 408
BseMI GCAATG 1 cut(s) 167
BseSI GKGCMC 1 cut(s) 11
Bsh1236I CGCG 1 cut(s) 36
BshFI GGCC 2 cut(s) 189, 421
BshNI GGYRCC 1 cut(s) 178
BsiHKCI CYCGRG 1 cut(s) 401
BslI CCNNNNNNNGG 4 cut(s) 36, 105, 303, 408
BsmAI GTCTC 1 cut(s) 74
BsmI GAATGC 1 cut(s) 109
BsnI GGCC 2 cut(s) 189, 421
BsoBI CYCGRG 1 cut(s) 401
Bsp1286I GDGCHC 1 cut(s) 11
Bsp143I GATC 2 cut(s) 50, 390
BspACI CCGC 2 cut(s) 36, 242
BspANI GGCC 2 cut(s) 189, 421
BspFNI CGCG 1 cut(s) 36
BspLI GGNNCC 2 cut(s) 180, 392
BspOI GCTAGC 1 cut(s) 29
BspPI GGATC 2 cut(s) 385, 398
BspT107I GGYRCC 1 cut(s) 178
BsrDI GCAATG 1 cut(s) 167
BssMI GATC 2 cut(s) 50, 390
Bst2UI CCWGG 1 cut(s) 183
BstBAI YACGTR 1 cut(s) 428
BstC8I GCNNGC 3 cut(s) 27, 38, 199
BstDEI CTNAG 1 cut(s) 193
BstF5I GGATG 2 cut(s) 293, 373
BstFNI CGCG 1 cut(s) 36
BstKTI GATC 2 cut(s) 53, 393
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 2 cut(s) 50, 390
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstSLI GKGCMC 1 cut(s) 11
BstSNI TACGTA 1 cut(s) 428
BstUI CGCG 1 cut(s) 36
BstX2I RGATCY 1 cut(s) 390
BstYI RGATCY 1 cut(s) 390
BsuRI GGCC 2 cut(s) 189, 421
BtsCI GGATG 2 cut(s) 293, 373
Cac8I GCNNGC 3 cut(s) 27, 38, 199
CsiI ACCWGGT 1 cut(s) 181
Csp6I GTAC 1 cut(s) 318
CviJI RGCY 9 cut(s) 25, 29, 40, 60, 97, 189, 197, 372, 421
CviKI_1 RGCY 9 cut(s) 25, 29, 40, 60, 97, 189, 197, 372, 421
CviQI GTAC 1 cut(s) 318
DdeI CTNAG 1 cut(s) 193
DpnI GATC 2 cut(s) 52, 392
DpnII GATC 2 cut(s) 50, 390
DraIII CACNNNGTG 1 cut(s) 185
Eco105I TACGTA 1 cut(s) 428
Eco88I CYCGRG 1 cut(s) 401
EcoRI GAATTC 1 cut(s) 288
EcoRII CCWGG 1 cut(s) 181
FauI CCCGC 1 cut(s) 29
FokI GGATG 2 cut(s) 280, 360
FspBI CTAG 2 cut(s) 26, 285
HaeIII GGCC 2 cut(s) 189, 421
HinfI GANTC 2 cut(s) 338, 357
Hpy188III TCNNGA 1 cut(s) 329
HpyCH4IV ACGT 2 cut(s) 154, 427
HpyCH4V TGCA 2 cut(s) 4, 255
HpyF3I CTNAG 1 cut(s) 193
HpySE526I ACGT 2 cut(s) 154, 427
Kzo9I GATC 2 cut(s) 50, 390
LpnPI CCDG 6 cut(s) 26, 168, 195, 211, 259, 289
LweI GCATC 1 cut(s) 457
MabI ACCWGGT 1 cut(s) 181
MaeI CTAG 2 cut(s) 26, 285
MaeII ACGT 2 cut(s) 154, 427
MaeIII GTNAC 1 cut(s) 140
MalI GATC 2 cut(s) 52, 392
MboI GATC 2 cut(s) 50, 390
MboII GAAGA 2 cut(s) 113, 257
MflI RGATCY 1 cut(s) 390
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 4 cut(s) 123, 145, 288, 448
MmeI TCCRAC 1 cut(s) 389
MnlI CCTC 1 cut(s) 200
MseI TTAA 1 cut(s) 234
MspR9I CCNGG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 109
MvaI CCWGG 1 cut(s) 183
MvnI CGCG 1 cut(s) 36
NdeII GATC 2 cut(s) 50, 390
NheI GCTAGC 1 cut(s) 25
NlaIV GGNNCC 2 cut(s) 180, 392
PctI GAATGC 1 cut(s) 109
PfeI GAWTC 2 cut(s) 338, 357
Ppu21I YACGTR 1 cut(s) 428
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspN4I GGNNCC 2 cut(s) 180, 392
PsuI RGATCY 1 cut(s) 390
RsaI GTAC 1 cut(s) 319
RsaNI GTAC 1 cut(s) 318
SaqAI TTAA 1 cut(s) 234
Sau3AI GATC 2 cut(s) 50, 390
ScrFI CCNGG 1 cut(s) 183
SduI GDGCHC 1 cut(s) 11
SetI ASST 3 cut(s) 157, 187, 430
SexAI ACCWGGT 1 cut(s) 181
SfaNI GCATC 1 cut(s) 457
SnaBI TACGTA 1 cut(s) 428
Sse9I AATT 4 cut(s) 123, 145, 288, 448
SsiI CCGC 2 cut(s) 36, 242
SspMI CTAG 2 cut(s) 26, 285
StyD4I CCNGG 1 cut(s) 181
TaiI ACGT 2 cut(s) 157, 430
TaqI TCGA 1 cut(s) 63
TasI AATT 4 cut(s) 123, 145, 288, 448
TfiI GAWTC 2 cut(s) 338, 357
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TspDTI ATGAA 2 cut(s) 35, 471
TspGWI ACGGA 4 cut(s) 7, 286, 335, 403
XapI RAATTY 1 cut(s) 288
XcmI CCANNNNNNNNNTGG 2 cut(s) 37, 300
XspI CTAG 2 cut(s) 26, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.