RchiOBHm_Chr7g0209391

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
26786016 .. 26786252
237 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18741

Sequence Viewer

Length: 237 bp
ATGCAAGGTCATTTGTCTGCTTGGTTAGTCAAACATGGGTTAGTTCATAGATCTTTGGGTTTCGATTACCAAGGGATAGAAACTTTACAAATAAAGCCCGAGGATTGGCATTCGATTGCCGTCATTTTATATGTATATGGTTACAATTATCTACGTTCCCAATGTGCTTATGATGTCGCATCCGGCGGGTTGTTAGCTAGTGTGTACTACCTTACGAATCCCTCCTGCTTATATTAA

Protein Analysis

78

Amino Acids

8.86

Weight (kDa)

6.37

Isoelectric Point (pI)

51.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 186
AfaI GTAC 1 cut(s) 206
AfiI CCNNNNNNNGG 1 cut(s) 105
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Ama87I CYCGRG 1 cut(s) 98
AvaI CYCGRG 1 cut(s) 98
BceAI ACGGC 1 cut(s) 104
BfaI CTAG 1 cut(s) 198
BglII AGATCT 1 cut(s) 50
BmeT110I CYCGRG 1 cut(s) 98
BmsI GCATC 1 cut(s) 188
BsaJI CCNNGG 2 cut(s) 70, 99
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseDI CCNNGG 2 cut(s) 70, 99
BseGI GGATG 1 cut(s) 179
BseLI CCNNNNNNNGG 1 cut(s) 105
BsiHKCI CYCGRG 1 cut(s) 98
BsiSI CCGG 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 105
BsmI GAATGC 1 cut(s) 109
BsoBI CYCGRG 1 cut(s) 98
Bsp143I GATC 1 cut(s) 50
BspACI CCGC 1 cut(s) 186
BssECI CCNNGG 2 cut(s) 70, 99
BssMI GATC 1 cut(s) 50
BssT1I CCWWGG 1 cut(s) 70
BstF5I GGATG 1 cut(s) 179
BstKTI GATC 1 cut(s) 53
BstMBI GATC 1 cut(s) 50
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BtsCI GGATG 1 cut(s) 179
Csp6I GTAC 1 cut(s) 205
CviAII CATG 1 cut(s) 35
CviJI RGCY 2 cut(s) 97, 197
CviKI_1 RGCY 2 cut(s) 97, 197
CviQI GTAC 1 cut(s) 205
DpnI GATC 1 cut(s) 52
DpnII GATC 1 cut(s) 50
Eco130I CCWWGG 1 cut(s) 70
Eco88I CYCGRG 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 70
FaeI CATG 1 cut(s) 38
FaiI YATR 8 cut(s) 36, 48, 130, 132, 136, 138, 171, 232
FatI CATG 1 cut(s) 34
FauI CCCGC 1 cut(s) 179
FokI GGATG 1 cut(s) 166
FspBI CTAG 1 cut(s) 198
HapII CCGG 1 cut(s) 183
Hin1II CATG 1 cut(s) 38
HinfI GANTC 1 cut(s) 217
HpaII CCGG 1 cut(s) 183
Hpy166II GTNNAC 1 cut(s) 205
Hpy8I GTNNAC 1 cut(s) 205
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 1 cut(s) 50
LpnPI CCDG 1 cut(s) 196
LweI GCATC 1 cut(s) 188
MaeI CTAG 1 cut(s) 198
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 140
MalI GATC 1 cut(s) 52
MboI GATC 1 cut(s) 50
MflI RGATCY 1 cut(s) 50
MluCI AATT 1 cut(s) 145
MnlI CCTC 2 cut(s) 94, 232
MseI TTAA 1 cut(s) 235
MspI CCGG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 109
NdeII GATC 1 cut(s) 50
NlaIII CATG 1 cut(s) 38
PctI GAATGC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 217
PsuI RGATCY 1 cut(s) 50
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SaqAI TTAA 1 cut(s) 235
Sau3AI GATC 1 cut(s) 50
SetI ASST 4 cut(s) 10, 157, 199, 213
SfaNI GCATC 1 cut(s) 188
SgeI CNNG 9 cut(s) 17, 33, 47, 83, 110, 112, 195, 199, 210
Sse9I AATT 1 cut(s) 145
SsiI CCGC 1 cut(s) 186
SspMI CTAG 1 cut(s) 198
StyI CCWWGG 1 cut(s) 70
TaiI ACGT 1 cut(s) 157
TaqI TCGA 2 cut(s) 63, 113
TasI AATT 1 cut(s) 145
TatI WGTACW 1 cut(s) 204
TfiI GAWTC 1 cut(s) 217
Tru1I TTAA 1 cut(s) 235
Tru9I TTAA 1 cut(s) 235
TspDTI ATGAA 1 cut(s) 35
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.