Prupe.1G270900_v2.0.a1

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
27807660 .. 27807992
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G270900.1

Sequence Viewer

Length: 285 bp
ATGCAGGGTCGTTTGTCCGCTTGGTTAGTCAAACATGGGTTAGTTCATAGATCTTTGGGTTTCGATTACCAAGGAATAGAAACTTTACAAATAAAACCCGAGGATTGGCATTCGATTGCTGTCATTTTATATGTATATGGTTACAATTATCTACGTTCCCAATGTGCTTATGATGTAGCACCGGGCGGACTGTTAGCTAGTGTCTATCATCTTACGAGAATAGAGTATGGTATAGATCAACCAGAAGAGGTATGCATAAAAGTATTTGCCCCAAGGAGGAATCCT

Protein Analysis

95

Amino Acids

10.9

Weight (kDa)

6.89

Isoelectric Point (pI)

57.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 18, 186
AfiI CCNNNNNNNGG 2 cut(s) 105, 276
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Ama87I CYCGRG 1 cut(s) 98
AsuC2I CCSGG 1 cut(s) 183
AvaI CYCGRG 1 cut(s) 98
BcnI CCSGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 198
BglII AGATCT 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 183
BmeT110I CYCGRG 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 183
BpuMI CCSGG 1 cut(s) 183
BsaJI CCNNGG 3 cut(s) 70, 99, 272
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 276
BseDI CCNNGG 3 cut(s) 70, 99, 272
BseLI CCNNNNNNNGG 2 cut(s) 105, 276
BsiHKCI CYCGRG 1 cut(s) 98
BsiSI CCGG 1 cut(s) 182
BslI CCNNNNNNNGG 2 cut(s) 105, 276
BsmI GAATGC 1 cut(s) 109
BsoBI CYCGRG 1 cut(s) 98
Bsp143I GATC 2 cut(s) 50, 235
BspACI CCGC 2 cut(s) 18, 186
BssECI CCNNGG 3 cut(s) 70, 99, 272
BssMI GATC 2 cut(s) 50, 235
BssT1I CCWWGG 2 cut(s) 70, 272
Bst4CI ACNGT 1 cut(s) 192
Bst6I CTCTTC 1 cut(s) 240
BstKTI GATC 2 cut(s) 53, 238
BstMBI GATC 2 cut(s) 50, 235
BstSCI CCNGG 1 cut(s) 181
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
CviAII CATG 1 cut(s) 35
CviJI RGCY 1 cut(s) 197
CviKI_1 RGCY 1 cut(s) 197
DpnI GATC 2 cut(s) 52, 237
DpnII GATC 2 cut(s) 50, 235
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
EciI GGCGGA 1 cut(s) 201
Eco130I CCWWGG 2 cut(s) 70, 272
Eco88I CYCGRG 1 cut(s) 98
EcoT14I CCWWGG 2 cut(s) 70, 272
EcoT22I ATGCAT 1 cut(s) 257
ErhI CCWWGG 2 cut(s) 70, 272
FaeI CATG 1 cut(s) 38
FatI CATG 1 cut(s) 34
FspBI CTAG 1 cut(s) 198
HapII CCGG 1 cut(s) 182
Hin1II CATG 1 cut(s) 38
HinfI GANTC 1 cut(s) 280
HpaII CCGG 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 4, 255
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 2 cut(s) 50, 235
LpnPI CCDG 2 cut(s) 195, 255
MaeI CTAG 1 cut(s) 198
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 140
MalI GATC 2 cut(s) 52, 237
MboI GATC 2 cut(s) 50, 235
MboII GAAGA 1 cut(s) 257
MflI RGATCY 1 cut(s) 50
MluCI AATT 1 cut(s) 145
MnlI CCTC 3 cut(s) 94, 241, 270
Mph1103I ATGCAT 1 cut(s) 257
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 109
NciI CCSGG 1 cut(s) 183
NdeII GATC 2 cut(s) 50, 235
NlaIII CATG 1 cut(s) 38
NsiI ATGCAT 1 cut(s) 257
PctI GAATGC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 280
PsuI RGATCY 1 cut(s) 50
Sau3AI GATC 2 cut(s) 50, 235
ScrFI CCNGG 1 cut(s) 183
SetI ASST 3 cut(s) 157, 199, 252
Sse9I AATT 1 cut(s) 145
SsiI CCGC 2 cut(s) 18, 186
SspMI CTAG 1 cut(s) 198
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 2 cut(s) 70, 272
TaaI ACNGT 1 cut(s) 192
TaiI ACGT 1 cut(s) 157
TaqI TCGA 2 cut(s) 63, 113
TasI AATT 1 cut(s) 145
TfiI GAWTC 1 cut(s) 280
TspDTI ATGAA 1 cut(s) 35
XspI CTAG 1 cut(s) 198
Zsp2I ATGCAT 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.