FvH4_3g38401

NDH shuttles electrons from NAD(P)H plastoquinone, via FMN and iron-sulfur (Fe-S) centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be plastoquinone. Couples the redox reaction to proton translocation, and thus conserves the redox energy in a proton gradient

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
32798941 .. 32799508
568 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g38401.t1

Sequence Viewer

Length: 366 bp
ATGGAGATGGGTGCTTATGATGTAGCACCAGGCGGGCTGTTAGCTAGTGTGTACCATCTTACTAGAATAGAGTATGGTATAGAACAACTGGAAGTGAGTAATGGCCAAACTGATGCGTACACCTTGACACCAGTTTTGAGGGGTGGCATAGCTGAACTGAGACTGCAGCGGAGTTCAGGACCTCTACTGGATTCAAATTCAGGGAAAATCAGAAGGCTGAGATCTCTCTCTGCAAATCAACCTCAAATTTTCTTAGCAATCCAGCTCCAGCCTCAGTCAAAAGGTAAACTCTACACCTCACTTAGAATGAAAAATTACAATGTATCGGAGACAACTGAAATAGAAGAAGAAATGAATCGGTATTGA

Protein Analysis

122

Amino Acids

13.55

Weight (kDa)

6.58

Isoelectric Point (pI)

66.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 33, 169
AcoI YGGCCR 1 cut(s) 103
AcsI RAATTY 2 cut(s) 196, 246
AfaI GTAC 2 cut(s) 53, 119
AgsI TTSAA 1 cut(s) 195
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 3 cut(s) 44, 152, 265
AluI AGCT 3 cut(s) 44, 152, 265
Alw26I GTCTC 2 cut(s) 154, 323
AoxI GGCC 1 cut(s) 103
ApeKI GCWGC 1 cut(s) 166
ApoI RAATTY 2 cut(s) 196, 246
ArsI GACNNNNNNTTYG 2 cut(s) 118, 150
AspS9I GGNCC 1 cut(s) 179
AvaII GGWCC 1 cut(s) 179
BalI TGGCCA 1 cut(s) 105
BbvI GCAGC 1 cut(s) 178
BccI CCATC 1 cut(s) 63
BciT130I CCWGG 1 cut(s) 30
BcoDI GTCTC 2 cut(s) 154, 323
BfaI CTAG 2 cut(s) 45, 63
BfmI CTRYAG 1 cut(s) 164
BglII AGATCT 1 cut(s) 221
BisI GCNGC 1 cut(s) 167
BlsI GCNGC 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 30
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 251
Bse1I ACTGG 3 cut(s) 93, 131, 192
BseBI CCWGG 1 cut(s) 30
BseMII CTCAG 3 cut(s) 149, 209, 287
BseNI ACTGG 3 cut(s) 93, 131, 192
BseXI GCAGC 1 cut(s) 178
BshFI GGCC 1 cut(s) 105
BsmAI GTCTC 2 cut(s) 154, 323
BsnI GGCC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 221
BspACI CCGC 2 cut(s) 33, 169
BspANI GGCC 1 cut(s) 105
BspCNI CTCAG 3 cut(s) 150, 210, 286
BspMAI CTGCAG 1 cut(s) 168
BsrI ACTGG 3 cut(s) 93, 131, 192
BssMI GATC 1 cut(s) 221
Bst2UI CCWGG 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 35
BstDEI CTNAG 5 cut(s) 158, 218, 253, 273, 302
BstKTI GATC 1 cut(s) 224
BstMAI GTCTC 2 cut(s) 154, 323
BstMBI GATC 1 cut(s) 221
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 221
BstYI RGATCY 1 cut(s) 221
BsuRI GGCC 1 cut(s) 105
Cac8I GCNNGC 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 179
Csp6I GTAC 2 cut(s) 52, 118
CviJI RGCY 7 cut(s) 37, 44, 105, 152, 217, 265, 271
CviKI_1 RGCY 7 cut(s) 37, 44, 105, 152, 217, 265, 271
CviQI GTAC 2 cut(s) 52, 118
DdeI CTNAG 5 cut(s) 158, 218, 253, 273, 302
DpnI GATC 1 cut(s) 223
DpnII GATC 1 cut(s) 221
EaeI YGGCCR 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 179
EcoO109I RGGNCCY 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 4 cut(s) 18, 75, 80, 149
FauI CCCGC 1 cut(s) 26
Fnu4HI GCNGC 1 cut(s) 167
Fsp4HI GCNGC 1 cut(s) 167
FspBI CTAG 2 cut(s) 45, 63
GluI GCNGC 1 cut(s) 167
GsuI CTGGAG 1 cut(s) 251
HaeIII GGCC 1 cut(s) 105
HinfI GANTC 2 cut(s) 191, 355
Hpy166II GTNNAC 3 cut(s) 52, 120, 287
Hpy188I TCNGA 2 cut(s) 212, 328
Hpy188III TCNNGA 1 cut(s) 177
Hpy8I GTNNAC 3 cut(s) 52, 120, 287
HpyAV CCTTC 1 cut(s) 207
HpyCH4V TGCA 2 cut(s) 166, 233
HpyF3I CTNAG 5 cut(s) 158, 218, 253, 273, 302
Kzo9I GATC 1 cut(s) 221
LmnI GCTCC 1 cut(s) 270
LpnPI CCDG 9 cut(s) 15, 42, 74, 144, 162, 173, 186, 275, 281
Lsp1109I GCAGC 1 cut(s) 178
LweI GCATC 1 cut(s) 103
MaeI CTAG 2 cut(s) 45, 63
MalI GATC 1 cut(s) 223
MboI GATC 1 cut(s) 221
MboII GAAGA 2 cut(s) 356, 359
MflI RGATCY 1 cut(s) 221
MlsI TGGCCA 1 cut(s) 105
MluCI AATT 3 cut(s) 196, 246, 313
MluNI TGGCCA 1 cut(s) 105
MnlI CCTC 5 cut(s) 132, 192, 252, 282, 307
Mox20I TGGCCA 1 cut(s) 105
MscI TGGCCA 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 105
MspA1I CMGCKG 1 cut(s) 169
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NdeII GATC 1 cut(s) 221
PfeI GAWTC 2 cut(s) 191, 355
PkrI GCNGC 1 cut(s) 168
PpuMI RGGWCCY 1 cut(s) 179
Psp5II RGGWCCY 1 cut(s) 179
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspPI GGNCC 1 cut(s) 179
PspPPI RGGWCCY 1 cut(s) 179
PstI CTGCAG 1 cut(s) 168
PsuI RGATCY 1 cut(s) 221
RsaI GTAC 2 cut(s) 53, 119
RsaNI GTAC 2 cut(s) 52, 118
SatI GCNGC 1 cut(s) 167
Sau3AI GATC 1 cut(s) 221
Sau96I GGNCC 1 cut(s) 179
ScrFI CCNGG 1 cut(s) 30
SetI ASST 8 cut(s) 46, 125, 154, 184, 244, 267, 286, 299
SfaNI GCATC 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 164
SinI GGWCC 1 cut(s) 179
Sse9I AATT 3 cut(s) 196, 246, 313
SsiI CCGC 2 cut(s) 33, 169
SspMI CTAG 2 cut(s) 45, 63
StyD4I CCNGG 1 cut(s) 28
TasI AATT 3 cut(s) 196, 246, 313
TfiI GAWTC 2 cut(s) 191, 355
TseI GCWGC 1 cut(s) 166
TspDTI ATGAA 1 cut(s) 323
VpaK11BI GGWCC 1 cut(s) 179
XapI RAATTY 2 cut(s) 196, 246
XspI CTAG 2 cut(s) 45, 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.