FvH4_1g11510

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
6282859 .. 6284567
1709 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g11510.t2

Sequence Viewer

Length: 270 bp
ATGAAAGACGATTACGAGATTGAAGAGAAAAAGCAAGCTGCTGCTGATGTATTGGACAACTATTCAAAGTTTGTAATGGCATGCATTGGAAATAATGTTCGGCCTTGTGACATGAGGTTGCATCTGATGAAGGAGATTTCAGGTCTACCAACTTCTTTGAAGAAAGATTCGTCCCAGAGAGCAGCTTCTCCTGATCTAATGGGTGAATCGTCAAGCTCAGGTACTGCCAGACTAGATAAGACAGACAGTTTTCGAGATCGGCCACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.91

Weight (kDa)

5.76

Isoelectric Point (pI)

52.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014437)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 145
AcoI YGGCCR 1 cut(s) 260
AfaI GTAC 1 cut(s) 223
AgsI TTSAA 3 cut(s) 23, 66, 160
AloI GAACNNNNNNTCC 2 cut(s) 81, 113
AluBI AGCT 3 cut(s) 38, 185, 216
AluI AGCT 3 cut(s) 38, 185, 216
AlwNI CAGNNNCTG 1 cut(s) 224
AoxI GGCC 2 cut(s) 101, 260
ApeKI GCWGC 3 cut(s) 38, 41, 182
AsuHPI GGTGA 1 cut(s) 215
BbvI GCAGC 3 cut(s) 25, 28, 194
BfaI CTAG 1 cut(s) 233
BisI GCNGC 3 cut(s) 39, 42, 183
BlsI GCNGC 3 cut(s) 40, 43, 184
BmsI GCATC 1 cut(s) 130
Bpu10I CCTNAGC 1 cut(s) 217
BseMII CTCAG 1 cut(s) 231
BseXI GCAGC 3 cut(s) 25, 28, 194
BshFI GGCC 2 cut(s) 103, 262
BslFI GGGAC 1 cut(s) 157
BsmFI GGGAC 1 cut(s) 157
BsnI GGCC 2 cut(s) 103, 262
Bsp143I GATC 2 cut(s) 193, 256
BspANI GGCC 2 cut(s) 103, 262
BspCNI CTCAG 1 cut(s) 230
BssMI GATC 2 cut(s) 193, 256
Bst4CI ACNGT 1 cut(s) 248
Bst6I CTCTTC 1 cut(s) 18
BstC8I GCNNGC 2 cut(s) 36, 82
BstDEI CTNAG 1 cut(s) 217
BstKTI GATC 2 cut(s) 196, 259
BstMBI GATC 2 cut(s) 193, 256
BstNSI RCATGY 1 cut(s) 84
BstV1I GCAGC 3 cut(s) 25, 28, 194
BsuRI GGCC 2 cut(s) 103, 262
Cac8I GCNNGC 2 cut(s) 36, 82
CaiI CAGNNNCTG 1 cut(s) 224
Csp6I GTAC 1 cut(s) 222
CviAII CATG 2 cut(s) 81, 112
CviJI RGCY 5 cut(s) 38, 103, 185, 216, 262
CviKI_1 RGCY 5 cut(s) 38, 103, 185, 216, 262
CviQI GTAC 1 cut(s) 222
DdeI CTNAG 1 cut(s) 217
DpnI GATC 2 cut(s) 195, 258
DpnII GATC 2 cut(s) 193, 256
EaeI YGGCCR 1 cut(s) 260
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
EcoT22I ATGCAT 1 cut(s) 86
FaeI CATG 2 cut(s) 84, 115
FaiI YATR 2 cut(s) 82, 113
FaqI GGGAC 1 cut(s) 157
FatI CATG 2 cut(s) 80, 111
FblI GTMKAC 1 cut(s) 145
Fnu4HI GCNGC 3 cut(s) 39, 42, 183
Fsp4HI GCNGC 3 cut(s) 39, 42, 183
FspBI CTAG 1 cut(s) 233
GluI GCNGC 3 cut(s) 39, 42, 183
HaeIII GGCC 2 cut(s) 103, 262
Hin1II CATG 2 cut(s) 84, 115
HinfI GANTC 2 cut(s) 167, 206
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 2 cut(s) 191, 254
Hpy8I GTNNAC 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 124
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4V TGCA 2 cut(s) 84, 121
HpyF3I CTNAG 1 cut(s) 217
Hsp92II CATG 2 cut(s) 84, 115
Kzo9I GATC 2 cut(s) 193, 256
LpnPI CCDG 5 cut(s) 126, 188, 204, 204, 241
Lsp1109I GCAGC 3 cut(s) 25, 28, 194
LweI GCATC 1 cut(s) 130
MaeI CTAG 1 cut(s) 233
MaeIII GTNAC 1 cut(s) 107
MalI GATC 2 cut(s) 195, 258
MboI GATC 2 cut(s) 193, 256
MboII GAAGA 2 cut(s) 35, 172
MnlI CCTC 1 cut(s) 108
Mph1103I ATGCAT 1 cut(s) 86
NdeII GATC 2 cut(s) 193, 256
NlaIII CATG 2 cut(s) 84, 115
NmuCI GTSAC 1 cut(s) 107
NsiI ATGCAT 1 cut(s) 86
NspI RCATGY 1 cut(s) 84
PaeI GCATGC 1 cut(s) 84
PfeI GAWTC 2 cut(s) 167, 206
PkrI GCNGC 3 cut(s) 40, 43, 184
PstNI CAGNNNCTG 1 cut(s) 224
RsaI GTAC 1 cut(s) 223
RsaNI GTAC 1 cut(s) 222
SatI GCNGC 3 cut(s) 39, 42, 183
Sau3AI GATC 2 cut(s) 193, 256
SetI ASST 6 cut(s) 40, 119, 145, 187, 218, 223
SfaNI GCATC 1 cut(s) 130
SphI GCATGC 1 cut(s) 84
SspMI CTAG 1 cut(s) 233
TaaI ACNGT 1 cut(s) 248
TaqI TCGA 1 cut(s) 253
TfiI GAWTC 2 cut(s) 167, 206
TseFI GTSAC 1 cut(s) 107
TseI GCWGC 3 cut(s) 38, 41, 182
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 17, 143
XceI RCATGY 1 cut(s) 84
XmiI GTMKAC 1 cut(s) 145
XspI CTAG 1 cut(s) 233
Zsp2I ATGCAT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.