FvH4_3g19851

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
13014067 .. 13014652
586 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g19851.t1

Sequence Viewer

Length: 240 bp
ATGGCTCTAGATTGCATTCATCATAATCTAAATAGCATTGTGGCTAAAGTGATTGGCATTATTAGAAGAAAGTCCTTGATCAAAGAGTTAGCTGCTATGTACCATGCCGAGTGCCTTTCATACTGTCAAGAGCTTTTGCAGCTTCAACGAAAAGGGGATGAGGTCAGATGCCATGCTCTCATACTTGTTTCTATGTTTCCTTTGCTTAATATTACTCATTTGATAAAGATGTATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.06

Weight (kDa)

8.8

Isoelectric Point (pI)

63.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012523)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 101
AgsI TTSAA 1 cut(s) 146
AluBI AGCT 3 cut(s) 92, 133, 142
AluI AGCT 3 cut(s) 92, 133, 142
ApeKI GCWGC 2 cut(s) 92, 139
BbvI GCAGC 2 cut(s) 79, 151
BclI TGATCA 1 cut(s) 78
BfaI CTAG 1 cut(s) 8
BisI GCNGC 2 cut(s) 93, 140
BlsI GCNGC 2 cut(s) 94, 141
BmsI GCATC 1 cut(s) 158
BseGI GGATG 1 cut(s) 163
BseXI GCAGC 2 cut(s) 79, 151
BsmI GAATGC 1 cut(s) 15
Bsp143I GATC 1 cut(s) 78
BssMI GATC 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 125
BstF5I GGATG 1 cut(s) 163
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 139
BstV1I GCAGC 2 cut(s) 79, 151
BtsCI GGATG 1 cut(s) 163
Csp6I GTAC 1 cut(s) 100
CviAII CATG 2 cut(s) 104, 173
CviJI RGCY 5 cut(s) 5, 44, 92, 133, 142
CviKI_1 RGCY 5 cut(s) 5, 44, 92, 133, 142
CviQI GTAC 1 cut(s) 100
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
FaeI CATG 2 cut(s) 107, 176
FaiI YATR 8 cut(s) 24, 98, 105, 121, 174, 182, 194, 234
FatI CATG 2 cut(s) 103, 172
FbaI TGATCA 1 cut(s) 78
Fnu4HI GCNGC 2 cut(s) 93, 140
FokI GGATG 1 cut(s) 170
Fsp4HI GCNGC 2 cut(s) 93, 140
FspBI CTAG 1 cut(s) 8
GluI GCNGC 2 cut(s) 93, 140
Hin1II CATG 2 cut(s) 107, 176
Hpy188I TCNGA 1 cut(s) 167
Hpy188III TCNNGA 2 cut(s) 8, 128
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 2 cut(s) 15, 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 139
Hsp92II CATG 2 cut(s) 107, 176
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 78
Lsp1109I GCAGC 2 cut(s) 79, 151
LweI GCATC 1 cut(s) 158
MaeI CTAG 1 cut(s) 8
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 1 cut(s) 78
MnlI CCTC 1 cut(s) 154
MseI TTAA 1 cut(s) 207
Mva1269I GAATGC 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 139
NdeII GATC 1 cut(s) 78
NlaIII CATG 2 cut(s) 107, 176
NmeAIII GCCGAG 1 cut(s) 133
PctI GAATGC 1 cut(s) 15
PkrI GCNGC 2 cut(s) 94, 141
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
SaqAI TTAA 1 cut(s) 207
SatI GCNGC 2 cut(s) 93, 140
Sau3AI GATC 1 cut(s) 78
SetI ASST 4 cut(s) 94, 135, 144, 165
SfaNI GCATC 1 cut(s) 158
SgeI CNNG 7 cut(s) 20, 88, 116, 121, 140, 185, 197
SspI AATATT 1 cut(s) 211
SspMI CTAG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 125
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseI GCWGC 2 cut(s) 92, 139
TspDTI ATGAA 2 cut(s) 8, 108
XbaI TCTAGA 1 cut(s) 7
XspI CTAG 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.