FvH4_4g28390

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
29059242 .. 29060176
935 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g28390.t2

Sequence Viewer

Length: 192 bp
ATGGCATCAATGAAGGTTGAGAGAGGAGTTGGGACTCAACTGTTTGGGCAGGCCAAGAAAGAACCTGCCGTCGCCAAGGATGGTGCAGCCAAAATTCCAGCATCTAAAGCAGCACCAAAGAAGGCTGCAGCCAAGCCAGCTCCAGCACCTAAGAAGAAGGGTAAAGGTGGCAAAGCTGCAGCAAAGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.24

Weight (kDa)

10.6

Isoelectric Point (pI)

21.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017291)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 73
AcsI RAATTY 1 cut(s) 93
AluBI AGCT 2 cut(s) 140, 176
AluI AGCT 2 cut(s) 140, 176
AoxI GGCC 1 cut(s) 51
ApeKI GCWGC 6 cut(s) 86, 110, 125, 128, 176, 179
ApoI RAATTY 1 cut(s) 93
BbvI GCAGC 5 cut(s) 98, 112, 122, 140, 163
BccI CCATC 1 cut(s) 74
BceAI ACGGC 1 cut(s) 53
BfmI CTRYAG 2 cut(s) 126, 177
BfuAI ACCTGC 1 cut(s) 73
BisI GCNGC 6 cut(s) 87, 111, 126, 129, 177, 180
BlsI GCNGC 6 cut(s) 88, 112, 127, 130, 178, 181
BmsI GCATC 2 cut(s) 14, 110
BpmI CTGGAG 1 cut(s) 126
BsaJI CCNNGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 75
BseGI GGATG 1 cut(s) 85
BseRI GAGGAG 1 cut(s) 39
BseXI GCAGC 5 cut(s) 98, 112, 122, 140, 163
BsgI GTGCAG 1 cut(s) 105
BshFI GGCC 1 cut(s) 53
BslFI GGGAC 1 cut(s) 46
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 1 cut(s) 53
BspANI GGCC 1 cut(s) 53
BspMAI CTGCAG 2 cut(s) 130, 181
BspMI ACCTGC 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 51, 138
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 85
BstMWI GCNNNNNNNGC 2 cut(s) 107, 137
BstSFI CTRYAG 2 cut(s) 126, 177
BstV1I GCAGC 5 cut(s) 98, 112, 122, 140, 163
BsuRI GGCC 1 cut(s) 53
BtsCI GGATG 1 cut(s) 85
BveI ACCTGC 1 cut(s) 73
Cac8I GCNNGC 2 cut(s) 51, 138
CviJI RGCY 7 cut(s) 53, 89, 125, 131, 136, 140, 176
CviKI_1 RGCY 7 cut(s) 53, 89, 125, 131, 136, 140, 176
DdeI CTNAG 1 cut(s) 150
Eco130I CCWWGG 1 cut(s) 75
EcoT14I CCWWGG 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 75
FaqI GGGAC 1 cut(s) 46
Fnu4HI GCNGC 6 cut(s) 87, 111, 126, 129, 177, 180
FokI GGATG 1 cut(s) 92
Fsp4HI GCNGC 6 cut(s) 87, 111, 126, 129, 177, 180
GluI GCNGC 6 cut(s) 87, 111, 126, 129, 177, 180
GsuI CTGGAG 1 cut(s) 126
HaeIII GGCC 1 cut(s) 53
HinfI GANTC 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 74
HpyAV CCTTC 3 cut(s) 7, 115, 151
HpyCH4III ACNGT 1 cut(s) 42
HpyCH4V TGCA 3 cut(s) 86, 128, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 137
HpyF3I CTNAG 1 cut(s) 150
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 5 cut(s) 35, 78, 111, 150, 156
Lsp1109I GCAGC 5 cut(s) 98, 112, 122, 140, 163
LweI GCATC 2 cut(s) 14, 110
MboII GAAGA 1 cut(s) 166
MluCI AATT 1 cut(s) 93
MlyI GAGTC 1 cut(s) 28
MnlI CCTC 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 107, 137
PkrI GCNGC 6 cut(s) 88, 112, 127, 130, 178, 181
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PstI CTGCAG 2 cut(s) 130, 181
SatI GCNGC 6 cut(s) 87, 111, 126, 129, 177, 180
SchI GAGTC 1 cut(s) 28
SetI ASST 6 cut(s) 18, 67, 142, 151, 169, 178
SfaNI GCATC 2 cut(s) 14, 110
SfcI CTRYAG 2 cut(s) 126, 177
SgeI CNNG 8 cut(s) 62, 67, 77, 88, 110, 145, 149, 155
Sse9I AATT 1 cut(s) 93
StyI CCWWGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 42
TasI AATT 1 cut(s) 93
TseI GCWGC 6 cut(s) 86, 110, 125, 128, 176, 179
TspDTI ATGAA 1 cut(s) 26
XapI RAATTY 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.