Rroxscaffold_5G00377500

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
58086212 .. 58086828
617 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00377500.1

Sequence Viewer

Length: 198 bp
ATGGCATCAATGAAGGCCGAGAGAGGAGTTGGGACTCAACTGTTTGGGCAGGCCAAGAAAGAACCTGCCGTCGCCAAGGCTGGCGATGGTGCAGCCAAAACTTCAGCATCTAAAGCAGGACCAAAGAAGGCTGCAGCCAAGCCTGCTCCTGCACCCAAGAAGAAGGGTAAAGGTGGCAAAGCTGCAGCCAAGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.3

Weight (kDa)

10.6

Isoelectric Point (pI)

18.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017291)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 73
AcuI CTGAAG 1 cut(s) 87
AluBI AGCT 1 cut(s) 182
AluI AGCT 1 cut(s) 182
AoxI GGCC 2 cut(s) 15, 51
ApeKI GCWGC 5 cut(s) 92, 131, 134, 182, 185
AspS9I GGNCC 1 cut(s) 119
AvaII GGWCC 1 cut(s) 119
BbvI GCAGC 4 cut(s) 104, 118, 146, 169
BccI CCATC 1 cut(s) 80
BceAI ACGGC 1 cut(s) 53
BfmI CTRYAG 2 cut(s) 132, 183
BfuAI ACCTGC 1 cut(s) 73
BisI GCNGC 5 cut(s) 93, 132, 135, 183, 186
BlsI GCNGC 5 cut(s) 94, 133, 136, 184, 187
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmsI GCATC 2 cut(s) 14, 116
BsaJI CCNNGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 75
BseRI GAGGAG 1 cut(s) 39
BseXI GCAGC 4 cut(s) 104, 118, 146, 169
BsgI GTGCAG 2 cut(s) 111, 135
BshFI GGCC 2 cut(s) 17, 53
BslFI GGGAC 1 cut(s) 46
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 2 cut(s) 17, 53
BspANI GGCC 2 cut(s) 17, 53
BspMAI CTGCAG 2 cut(s) 136, 187
BspMI ACCTGC 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 42
BstC8I GCNNGC 3 cut(s) 51, 82, 144
BstMWI GCNNNNNNNGC 2 cut(s) 113, 143
BstSFI CTRYAG 2 cut(s) 132, 183
BstV1I GCAGC 4 cut(s) 104, 118, 146, 169
BsuRI GGCC 2 cut(s) 17, 53
BtgZI GCGATG 1 cut(s) 99
BveI ACCTGC 1 cut(s) 73
Cac8I GCNNGC 3 cut(s) 51, 82, 144
Cfr13I GGNCC 1 cut(s) 119
CviJI RGCY 9 cut(s) 17, 53, 80, 95, 131, 137, 142, 182, 188
CviKI_1 RGCY 9 cut(s) 17, 53, 80, 95, 131, 137, 142, 182, 188
Eco130I CCWWGG 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 119
Eco57I CTGAAG 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 75
FaqI GGGAC 1 cut(s) 46
Fnu4HI GCNGC 5 cut(s) 93, 132, 135, 183, 186
Fsp4HI GCNGC 5 cut(s) 93, 132, 135, 183, 186
GluI GCNGC 5 cut(s) 93, 132, 135, 183, 186
HaeIII GGCC 2 cut(s) 17, 53
HinfI GANTC 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 74
HpyAV CCTTC 3 cut(s) 7, 121, 157
HpyCH4III ACNGT 1 cut(s) 42
HpyCH4V TGCA 4 cut(s) 92, 134, 152, 185
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 143
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 6 cut(s) 35, 66, 78, 102, 156, 162
Lsp1109I GCAGC 4 cut(s) 104, 118, 146, 169
LweI GCATC 2 cut(s) 14, 116
MboII GAAGA 1 cut(s) 172
MlyI GAGTC 1 cut(s) 28
MnlI CCTC 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 113, 143
NmeAIII GCCGAG 1 cut(s) 43
PkrI GCNGC 5 cut(s) 94, 133, 136, 184, 187
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 119
PstI CTGCAG 2 cut(s) 136, 187
SatI GCNGC 5 cut(s) 93, 132, 135, 183, 186
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 28
SetI ASST 3 cut(s) 67, 175, 184
SfaNI GCATC 2 cut(s) 14, 116
SfcI CTRYAG 2 cut(s) 132, 183
SinI GGWCC 1 cut(s) 119
StyI CCWWGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 42
TseI GCWGC 5 cut(s) 92, 131, 134, 182, 185
TspDTI ATGAA 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.