MD00G1082000.v1.1

Organ-specific protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
16329604 .. 16330236
633 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1082000.v1.1.491

Sequence Viewer

Length: 330 bp
ATGAAGTTCTCCATCTCTTGCCTTCTGCTAATTCTGTCGTCCCTTCTATTGTTGTCCCAGAACAGCTATGCAAGAAAAGACTCTGGAGGCTACTGGAAGAGTGTGATGAATGACCAGCCCATGCCAGAAGCCATTAAAGGCCTGTTTGTCCATCACGAACAAGAAGATCAAGTGCCGTCGAAAGAAAAGAGCCATTTTGTTAGGGACTTTGACATGAGGCCTAATGTTATAATATATCATGGTGCTCATCATCATCACCAGGATCAGCCTGCAGAGAAGAAGCCCTTTTTCCAGGAAACATCTTACATACAAACAGTCAACCATGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.65

Weight (kDa)

6.74

Isoelectric Point (pI)

42.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Organ_specific PF10950 26 - 63 5.7e-08 Organ specific protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013128)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 230
AclWI GGATC 1 cut(s) 270
AjnI CCWGG 2 cut(s) 258, 291
AluBI AGCT 1 cut(s) 66
AluI AGCT 1 cut(s) 66
Alw21I GWGCWC 1 cut(s) 247
AlwI GGATC 1 cut(s) 270
AoxI GGCC 2 cut(s) 139, 218
AsuHPI GGTGA 1 cut(s) 248
Bbv12I GWGCWC 1 cut(s) 247
BccI CCATC 2 cut(s) 20, 159
BceAI ACGGC 1 cut(s) 160
BciT130I CCWGG 2 cut(s) 260, 293
BfmI CTRYAG 1 cut(s) 270
Bme1390I CCNGG 2 cut(s) 260, 293
BmrFI CCNGG 2 cut(s) 260, 293
BpmI CTGGAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 322
Bse1I ACTGG 1 cut(s) 98
BseBI CCWGG 2 cut(s) 260, 293
BseDI CCNNGG 1 cut(s) 322
BseNI ACTGG 1 cut(s) 98
BshFI GGCC 2 cut(s) 141, 220
BsiHKAI GWGCWC 1 cut(s) 247
BslFI GGGAC 3 cut(s) 25, 40, 218
BsmFI GGGAC 3 cut(s) 25, 40, 218
BsnI GGCC 2 cut(s) 141, 220
Bsp1286I GDGCHC 1 cut(s) 247
Bsp143I GATC 2 cut(s) 166, 262
Bsp19I CCATGG 1 cut(s) 322
BspANI GGCC 2 cut(s) 141, 220
BspMAI CTGCAG 1 cut(s) 274
BspPI GGATC 1 cut(s) 270
BsrI ACTGG 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 322
BssMI GATC 2 cut(s) 166, 262
BssT1I CCWWGG 1 cut(s) 322
Bst2UI CCWGG 2 cut(s) 260, 293
Bst4CI ACNGT 1 cut(s) 316
Bst6I CTCTTC 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 270
BstDSI CCRYGG 1 cut(s) 322
BstKTI GATC 2 cut(s) 169, 265
BstMBI GATC 2 cut(s) 166, 262
BstNI CCWGG 2 cut(s) 260, 293
BstSCI CCNGG 2 cut(s) 258, 291
BstSFI CTRYAG 1 cut(s) 270
BsuRI GGCC 2 cut(s) 141, 220
BtgI CCRYGG 1 cut(s) 322
Cac8I GCNNGC 1 cut(s) 270
CviAII CATG 4 cut(s) 121, 214, 239, 323
DpnI GATC 2 cut(s) 168, 264
DpnII GATC 2 cut(s) 166, 262
Eam1104I CTCTTC 1 cut(s) 92
EarI CTCTTC 1 cut(s) 92
Eco130I CCWWGG 1 cut(s) 322
Eco147I AGGCCT 2 cut(s) 141, 220
EcoRII CCWGG 2 cut(s) 258, 291
EcoT14I CCWWGG 1 cut(s) 322
ErhI CCWWGG 1 cut(s) 322
FaeI CATG 4 cut(s) 124, 217, 242, 326
FaiI YATR 8 cut(s) 69, 122, 215, 230, 235, 240, 308, 324
FalI AAGNNNNNCTT 2 cut(s) 269, 301
FaqI GGGAC 3 cut(s) 25, 40, 218
FatI CATG 4 cut(s) 120, 213, 238, 322
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 2 cut(s) 141, 220
Hin1II CATG 4 cut(s) 124, 217, 242, 326
HincII GTYRAC 1 cut(s) 319
HindII GTYRAC 1 cut(s) 319
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 248
Hpy166II GTNNAC 1 cut(s) 319
Hpy188III TCNNGA 2 cut(s) 84, 155
Hpy8I GTNNAC 1 cut(s) 319
Hpy99I CGWCG 1 cut(s) 181
HpyAV CCTTC 2 cut(s) 32, 53
HpyCH4III ACNGT 1 cut(s) 316
HpyCH4V TGCA 2 cut(s) 71, 272
Hsp92II CATG 4 cut(s) 124, 217, 242, 326
Kzo9I GATC 2 cut(s) 166, 262
MalI GATC 2 cut(s) 168, 264
MboI GATC 2 cut(s) 166, 262
MboII GAAGA 3 cut(s) 109, 176, 289
MhlI GDGCHC 1 cut(s) 247
MluCI AATT 1 cut(s) 30
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 2 cut(s) 80, 210
MseI TTAA 1 cut(s) 135
MspR9I CCNGG 2 cut(s) 260, 293
MvaI CCWGG 2 cut(s) 260, 293
NcoI CCATGG 1 cut(s) 322
NdeII GATC 2 cut(s) 166, 262
NlaIII CATG 4 cut(s) 124, 217, 242, 326
PceI AGGCCT 2 cut(s) 141, 220
PfoI TCCNGGA 1 cut(s) 291
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
PsiI TTATAA 1 cut(s) 230
Psp6I CCWGG 2 cut(s) 258, 291
PspGI CCWGG 2 cut(s) 258, 291
PstI CTGCAG 1 cut(s) 274
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 2 cut(s) 166, 262
SchI GAGTC 1 cut(s) 74
ScrFI CCNGG 2 cut(s) 260, 293
SduI GDGCHC 1 cut(s) 247
SetI ASST 1 cut(s) 68
SfcI CTRYAG 1 cut(s) 270
Sse9I AATT 1 cut(s) 30
SseBI AGGCCT 2 cut(s) 141, 220
StuI AGGCCT 2 cut(s) 141, 220
StyD4I CCNGG 2 cut(s) 258, 291
StyI CCWWGG 1 cut(s) 322
TaaI ACNGT 1 cut(s) 316
TaqI TCGA 1 cut(s) 179
TasI AATT 1 cut(s) 30
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TspDTI ATGAA 2 cut(s) 17, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.