MD01G1202800.v1.1

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0021175
Physical Location & Seq
Forward (+)
29852773 .. 29853063
291 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1202800.v1.1.491

Sequence Viewer

Length: 291 bp
ATGCACCACGACCCGGCCCTTTGGGGCGAGGACGTCAACAAGTTCAAGCCGGAGAGGTTCAAGGACGACATCCACGGCGGGTGTAAGCACAAGATGGGGTACTTGCCTTTTGGGTTTGGAGGGAGGATGTGCATTGGTCGAAACTTGACTTTCTTGGAGTACAAGATAGTTCTAACCCTAATTCTAACTAGGTTATCTTTTACCATCTCTCCAACTTATAGCCACTCGCCTTCCATTGAGCTCACTCTGAGGCCTTCGTATGGCCTGCCTCTAGCACTCCAGCCCCTCTAG

Protein Analysis

97

Amino Acids

10.93

Weight (kDa)

9.03

Isoelectric Point (pI)

63.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 1 - 80 7.1e-19 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021175)

Species Orthologous Gene IDs
malus_domestica MD01G1202800.v1.1
pyrus_communis pycom01g21210 pycom07g24890
rosa_multiflora Rmu_co7978254.1_g000001
rosa_samantha Rh1CG394500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 36
AciI CCGC 1 cut(s) 78
AcyI GRCGYC 1 cut(s) 33
AfaI GTAC 2 cut(s) 101, 161
AfiI CCNNNNNNNGG 2 cut(s) 13, 260
AgsI TTSAA 2 cut(s) 46, 61
AluBI AGCT 1 cut(s) 241
AluI AGCT 1 cut(s) 241
Alw21I GWGCWC 1 cut(s) 243
AoxI GGCC 3 cut(s) 15, 251, 262
AspS9I GGNCC 1 cut(s) 16
AsuC2I CCSGG 1 cut(s) 14
BanII GRGCYC 1 cut(s) 243
Bbv12I GWGCWC 1 cut(s) 243
BccI CCATC 2 cut(s) 88, 212
BceAI ACGGC 1 cut(s) 91
BcnI CCSGG 1 cut(s) 14
BfaI CTAG 3 cut(s) 189, 272, 289
Bme1390I CCNGG 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 14
BpmI CTGGAG 1 cut(s) 263
BpuMI CCSGG 1 cut(s) 14
BsaHI GRCGYC 1 cut(s) 33
BsaJI CCNNGG 1 cut(s) 73
BsaXI ACNNNNNCTCC 2 cut(s) 193, 223
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 260
BseDI CCNNGG 1 cut(s) 73
BseGI GGATG 2 cut(s) 69, 132
BseLI CCNNNNNNNGG 2 cut(s) 13, 260
BseMII CTCAG 1 cut(s) 239
BshFI GGCC 3 cut(s) 17, 253, 264
BsiHKAI GWGCWC 1 cut(s) 243
BsiSI CCGG 2 cut(s) 14, 50
BslI CCNNNNNNNGG 2 cut(s) 13, 260
BsnI GGCC 3 cut(s) 17, 253, 264
Bsp1286I GDGCHC 1 cut(s) 243
BspACI CCGC 1 cut(s) 78
BspANI GGCC 3 cut(s) 17, 253, 264
BspCNI CTCAG 1 cut(s) 240
BssECI CCNNGG 1 cut(s) 73
BssNI GRCGYC 1 cut(s) 33
BstACI GRCGYC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 266
BstDEI CTNAG 1 cut(s) 248
BstDSI CCRYGG 1 cut(s) 73
BstF5I GGATG 2 cut(s) 69, 132
BstSCI CCNGG 1 cut(s) 12
BsuRI GGCC 3 cut(s) 17, 253, 264
BtgI CCRYGG 1 cut(s) 73
BtsCI GGATG 2 cut(s) 69, 132
Cac8I GCNNGC 1 cut(s) 266
Cfr13I GGNCC 1 cut(s) 16
Csp6I GTAC 2 cut(s) 100, 160
CviJI RGCY 7 cut(s) 17, 49, 222, 241, 253, 264, 283
CviKI_1 RGCY 7 cut(s) 17, 49, 222, 241, 253, 264, 283
CviQI GTAC 2 cut(s) 100, 160
DdeI CTNAG 1 cut(s) 248
Ecl136II GAGCTC 1 cut(s) 241
Eco147I AGGCCT 1 cut(s) 253
Eco24I GRGCYC 1 cut(s) 243
Eco53kI GAGCTC 1 cut(s) 241
EcoICRI GAGCTC 1 cut(s) 241
EcoT38I GRGCYC 1 cut(s) 243
FaiI YATR 2 cut(s) 219, 261
FauI CCCGC 1 cut(s) 71
FokI GGATG 2 cut(s) 56, 139
FriOI GRGCYC 1 cut(s) 243
FspBI CTAG 3 cut(s) 189, 272, 289
GsuI CTGGAG 1 cut(s) 263
HaeIII GGCC 3 cut(s) 17, 253, 264
HapII CCGG 2 cut(s) 14, 50
Hin1I GRCGYC 1 cut(s) 33
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HpaII CCGG 2 cut(s) 14, 50
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 249
Hpy8I GTNNAC 1 cut(s) 37
HpyAV CCTTC 2 cut(s) 240, 264
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 2 cut(s) 4, 132
HpyF3I CTNAG 1 cut(s) 248
HpySE526I ACGT 1 cut(s) 33
Hsp92I GRCGYC 1 cut(s) 33
LpnPI CCDG 3 cut(s) 27, 63, 278
MaeI CTAG 3 cut(s) 189, 272, 289
MaeII ACGT 1 cut(s) 33
MhlI GDGCHC 1 cut(s) 243
MluCI AATT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 6 cut(s) 22, 48, 113, 117, 243, 279
MspI CCGG 2 cut(s) 14, 50
MspR9I CCNGG 1 cut(s) 14
NciI CCSGG 1 cut(s) 14
PceI AGGCCT 1 cut(s) 253
Psp124BI GAGCTC 1 cut(s) 243
PspPI GGNCC 1 cut(s) 16
RsaI GTAC 2 cut(s) 101, 161
RsaNI GTAC 2 cut(s) 100, 160
SacI GAGCTC 1 cut(s) 243
Sau96I GGNCC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 14
SduI GDGCHC 1 cut(s) 243
SetI ASST 4 cut(s) 36, 59, 194, 243
Sse9I AATT 1 cut(s) 180
SseBI AGGCCT 1 cut(s) 253
SsiI CCGC 1 cut(s) 78
SspMI CTAG 3 cut(s) 189, 272, 289
SstI GAGCTC 1 cut(s) 243
StuI AGGCCT 1 cut(s) 253
StyD4I CCNGG 1 cut(s) 12
TaiI ACGT 1 cut(s) 36
TaqI TCGA 1 cut(s) 139
TasI AATT 1 cut(s) 180
TatI WGTACW 1 cut(s) 159
XspI CTAG 3 cut(s) 189, 272, 289
ZraI GACGTC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.