pycom01g21210

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0021175
Physical Location & Seq
Forward (+)
19358300 .. 19358560
261 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g21210.1

Sequence Viewer

Length: 261 bp
ATGTGGATTGACATCGTCGGCATGCACCACGACCCGGCCCTTTGGGGCGAGGACGTCAACGAGTTCAAGCCGGAGAGGTTCAAGGACGACATCCACGGTGGGTGCAAGCACAAGATGGGGTACTTGCCCTTTGGGTTTGAAGGGAGGATGTGCATTGGTCGAAACTTAACTTTCATGGAGTACAAGATAGTTCTAACCCGCACAAGATGGGGTACTTGCCCTTTGGGTTTGGAGGGAGGATGTGCATTGGTCGAAACTTAA

Protein Analysis

87

Amino Acids

9.86

Weight (kDa)

6.04

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 5 - 67 2.1e-14 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021175)

Species Orthologous Gene IDs
malus_domestica MD01G1202800.v1.1
pyrus_communis pycom01g21210 pycom07g24890
rosa_multiflora Rmu_co7978254.1_g000001
rosa_samantha Rh1CG394500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 57
AciI CCGC 1 cut(s) 199
AcyI GRCGYC 1 cut(s) 54
AfaI GTAC 3 cut(s) 122, 182, 214
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 3 cut(s) 67, 82, 140
AoxI GGCC 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 37
AsuC2I CCSGG 1 cut(s) 35
BccI CCATC 2 cut(s) 109, 201
BcnI CCSGG 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 35
BpuMI CCSGG 1 cut(s) 35
BsaBI GATNNNNATC 1 cut(s) 11
BsaHI GRCGYC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 34
Bse8I GATNNNNATC 1 cut(s) 11
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 3 cut(s) 90, 153, 245
BseJI GATNNNNATC 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 34
BshFI GGCC 1 cut(s) 38
BsiSI CCGG 2 cut(s) 35, 71
BslI CCNNNNNNNGG 1 cut(s) 34
BsnI GGCC 1 cut(s) 38
BspACI CCGC 1 cut(s) 199
BspANI GGCC 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 94
BssNI GRCGYC 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 98
BstACI GRCGYC 1 cut(s) 54
BstC8I GCNNGC 2 cut(s) 23, 107
BstDSI CCRYGG 1 cut(s) 94
BstF5I GGATG 3 cut(s) 90, 153, 245
BstNSI RCATGY 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 33
BsuRI GGCC 1 cut(s) 38
BtgI CCRYGG 1 cut(s) 94
BtsCI GGATG 3 cut(s) 90, 153, 245
Cac8I GCNNGC 2 cut(s) 23, 107
Cfr13I GGNCC 1 cut(s) 37
Csp6I GTAC 3 cut(s) 121, 181, 213
CviAII CATG 2 cut(s) 22, 175
CviJI RGCY 2 cut(s) 38, 70
CviKI_1 RGCY 2 cut(s) 38, 70
CviQI GTAC 3 cut(s) 121, 181, 213
FaeI CATG 2 cut(s) 25, 178
FaiI YATR 2 cut(s) 23, 176
FatI CATG 2 cut(s) 21, 174
FauI CCCGC 1 cut(s) 206
FokI GGATG 3 cut(s) 77, 160, 252
HaeIII GGCC 1 cut(s) 38
HapII CCGG 2 cut(s) 35, 71
Hin1I GRCGYC 1 cut(s) 54
Hin1II CATG 2 cut(s) 25, 178
HincII GTYRAC 1 cut(s) 58
HindII GTYRAC 1 cut(s) 58
HpaII CCGG 2 cut(s) 35, 71
Hpy166II GTNNAC 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 58
Hpy99I CGWCG 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 54
HpyCH4V TGCA 4 cut(s) 25, 105, 153, 245
HpySE526I ACGT 1 cut(s) 54
Hsp92I GRCGYC 1 cut(s) 54
Hsp92II CATG 2 cut(s) 25, 178
LpnPI CCDG 2 cut(s) 48, 84
MaeII ACGT 1 cut(s) 54
MnlI CCTC 5 cut(s) 43, 69, 138, 226, 230
MseI TTAA 2 cut(s) 167, 259
MspI CCGG 2 cut(s) 35, 71
MspR9I CCNGG 1 cut(s) 35
NciI CCSGG 1 cut(s) 35
NlaIII CATG 2 cut(s) 25, 178
NspI RCATGY 1 cut(s) 25
PaeI GCATGC 1 cut(s) 25
PflFI GACNNNGTC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 37
PsyI GACNNNGTC 1 cut(s) 14
RsaI GTAC 3 cut(s) 122, 182, 214
RsaNI GTAC 3 cut(s) 121, 181, 213
SaqAI TTAA 2 cut(s) 167, 259
Sau96I GGNCC 1 cut(s) 37
ScrFI CCNGG 1 cut(s) 35
SetI ASST 2 cut(s) 57, 80
SphI GCATGC 1 cut(s) 25
SsiI CCGC 1 cut(s) 199
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 98
TaiI ACGT 1 cut(s) 57
TaqI TCGA 2 cut(s) 160, 252
TatI WGTACW 1 cut(s) 180
Tru1I TTAA 2 cut(s) 167, 259
Tru9I TTAA 2 cut(s) 167, 259
TspDTI ATGAA 1 cut(s) 163
Tth111I GACNNNGTC 1 cut(s) 14
XceI RCATGY 1 cut(s) 25
ZraI GACGTC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.