MD02G1201500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
19917549 .. 19919622
2074 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1201500.v1.1.491

Sequence Viewer

Length: 339 bp
ATGTGTTTGAACTCAGAATTGTCTCCGTCTAGTCCTCTATACTCTTCTTTTCGCCTTCGAAGGCCATCAAAGCAACACAGCTTTCGAGTTCGCCGCCTAATTAACAGGAACTGGAAGAGAAAACCAGCTGGACCAGCAGCAAAAGAGGCAGAGACCGGAGGGGCAAAGGTAGAGATGGAAATGAAGAACTTGAAGCTGTATATGGAGAACCAGAGCATTATAGAAGAGAATATTAAGCTGAGGAGAAAAGCACTTCTTCTTGTCCAAGAAAACCAAGCCTTGTTTTCACAGCTCCAACAAAAGCAGCTTTTTCTCAACAAAACAACAGCAGCAGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.97

Weight (kDa)

10.48

Isoelectric Point (pI)

81.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010873)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 94
AgsI TTSAA 2 cut(s) 10, 193
AluBI AGCT 6 cut(s) 81, 128, 196, 238, 292, 307
AluI AGCT 6 cut(s) 81, 128, 196, 238, 292, 307
Alw26I GTCTC 2 cut(s) 27, 146
AlwNI CAGNNNCTG 1 cut(s) 111
AoxI GGCC 1 cut(s) 62
ApeKI GCWGC 3 cut(s) 137, 304, 329
AspS9I GGNCC 1 cut(s) 131
AsuII TTCGAA 1 cut(s) 58
AvaII GGWCC 1 cut(s) 131
BbvCI CCTCAGC 1 cut(s) 239
BbvI GCAGC 2 cut(s) 149, 316
BccI CCATC 2 cut(s) 73, 169
BcoDI GTCTC 2 cut(s) 27, 146
BfaI CTAG 1 cut(s) 30
BisI GCNGC 4 cut(s) 94, 138, 305, 330
BlsI GCNGC 4 cut(s) 95, 139, 306, 331
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
Bpu10I CCTNAGC 1 cut(s) 239
Bpu14I TTCGAA 1 cut(s) 58
BsaI GGTCTC 1 cut(s) 146
BsaWI WCCGGW 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 116
BseMII CTCAG 2 cut(s) 27, 230
BseNI ACTGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 256
BseXI GCAGC 2 cut(s) 149, 316
BshFI GGCC 1 cut(s) 64
BsiSI CCGG 1 cut(s) 156
BsmAI GTCTC 2 cut(s) 27, 146
BsnI GGCC 1 cut(s) 64
Bso31I GGTCTC 1 cut(s) 146
Bsp119I TTCGAA 1 cut(s) 58
BspACI CCGC 1 cut(s) 94
BspANI GGCC 1 cut(s) 64
BspCNI CTCAG 2 cut(s) 26, 231
BspT104I TTCGAA 1 cut(s) 58
BspTNI GGTCTC 1 cut(s) 146
BsrI ACTGG 1 cut(s) 116
Bst6I CTCTTC 3 cut(s) 49, 110, 219
BstBI TTCGAA 1 cut(s) 58
BstDEI CTNAG 2 cut(s) 13, 239
BstMAI GTCTC 2 cut(s) 27, 146
BstMWI GCNNNNNNNGC 3 cut(s) 70, 134, 146
BstV1I GCAGC 2 cut(s) 149, 316
BsuRI GGCC 1 cut(s) 64
CaiI CAGNNNCTG 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 131
CviJI RGCY 8 cut(s) 64, 81, 128, 196, 238, 278, 292, 307
CviKI_1 RGCY 8 cut(s) 64, 81, 128, 196, 238, 278, 292, 307
DdeI CTNAG 2 cut(s) 13, 239
Eam1104I CTCTTC 3 cut(s) 49, 110, 219
EarI CTCTTC 3 cut(s) 49, 110, 219
Eco31I GGTCTC 1 cut(s) 146
Eco47I GGWCC 1 cut(s) 131
FaiI YATR 5 cut(s) 40, 201, 203, 221, 337
FalI AAGNNNNNCTT 2 cut(s) 240, 272
Fnu4HI GCNGC 4 cut(s) 94, 138, 305, 330
Fsp4HI GCNGC 4 cut(s) 94, 138, 305, 330
FspBI CTAG 1 cut(s) 30
GluI GCNGC 4 cut(s) 94, 138, 305, 330
HaeIII GGCC 1 cut(s) 64
HapII CCGG 1 cut(s) 156
HpaII CCGG 1 cut(s) 156
Hpy188I TCNGA 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 54, 65
HpyF10VI GCNNNNNNNGC 3 cut(s) 70, 134, 146
HpyF3I CTNAG 2 cut(s) 13, 239
LmnI GCTCC 1 cut(s) 297
LpnPI CCDG 7 cut(s) 91, 97, 114, 138, 147, 169, 224
Lsp1109I GCAGC 2 cut(s) 149, 316
MaeI CTAG 1 cut(s) 30
MboII GAAGA 5 cut(s) 36, 127, 196, 236, 248
MluCI AATT 2 cut(s) 17, 99
MmeI TCCRAC 1 cut(s) 319
MnlI CCTC 4 cut(s) 45, 139, 152, 234
MseI TTAA 2 cut(s) 102, 234
MspA1I CMGCKG 1 cut(s) 128
MspI CCGG 1 cut(s) 156
MwoI GCNNNNNNNGC 3 cut(s) 70, 134, 146
NspV TTCGAA 1 cut(s) 58
PkrI GCNGC 4 cut(s) 95, 139, 306, 331
PspPI GGNCC 1 cut(s) 131
PstNI CAGNNNCTG 1 cut(s) 111
PvuII CAGCTG 1 cut(s) 128
SaqAI TTAA 2 cut(s) 102, 234
SatI GCNGC 4 cut(s) 94, 138, 305, 330
Sau96I GGNCC 1 cut(s) 131
SetI ASST 7 cut(s) 83, 130, 171, 198, 240, 294, 309
SfuI TTCGAA 1 cut(s) 58
SinI GGWCC 1 cut(s) 131
Sse9I AATT 2 cut(s) 17, 99
SsiI CCGC 1 cut(s) 94
SspI AATATT 1 cut(s) 232
SspMI CTAG 1 cut(s) 30
TaqI TCGA 2 cut(s) 58, 85
TasI AATT 2 cut(s) 17, 99
TauI GCSGC 1 cut(s) 96
Tru1I TTAA 2 cut(s) 102, 234
Tru9I TTAA 2 cut(s) 102, 234
TseI GCWGC 3 cut(s) 137, 304, 329
TspDTI ATGAA 1 cut(s) 197
TspGWI ACGGA 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 131
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.