Prupe.2G147300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
20358448 .. 20359638
1191 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G147300.1

Sequence Viewer

Length: 318 bp
ATGTGTATGAACTCCTCAGAAATGACTCCATGCAGTCCTCAATACTCTGCTTTTCGCCTTCGAAGGCCATCAAACCAACATAACTTTCGAGTTCACCGCTTAATCAACAGGAAGAGGAAAACAGCAAAAGAACCAAAAGGGGCAGAGATAGGAGGTGCAAAGGTAGAGATGGAAATCAAGAACCTGAAGCTATACATGGAGAATCAGAGCATTATAGAAGAGAACAAGAAGCTGAGGAGAAAAGCACTTCTTCTTGTCCAAGAGAACCAAGCCTTGTTTTCACAGCTCCAACAGAAGAAGCTCTCTCCCAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.3

Weight (kDa)

10.29

Isoelectric Point (pI)

73.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010873)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 97
AcuI CTGAAG 1 cut(s) 206
AjuI GAANNNNNNNTTGG 2 cut(s) 69, 101
AluBI AGCT 4 cut(s) 190, 232, 286, 301
AluI AGCT 4 cut(s) 190, 232, 286, 301
AoxI GGCC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 86
AsuII TTCGAA 1 cut(s) 61
BbvCI CCTCAGC 1 cut(s) 233
BccI CCATC 2 cut(s) 76, 163
Bpu10I CCTNAGC 1 cut(s) 233
Bpu14I TTCGAA 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 173
Bse8I GATNNNNATC 1 cut(s) 173
BseJI GATNNNNATC 1 cut(s) 173
BseMII CTCAG 2 cut(s) 30, 224
BseRI GAGGAG 2 cut(s) 4, 250
BshFI GGCC 1 cut(s) 67
BsnI GGCC 1 cut(s) 67
Bsp119I TTCGAA 1 cut(s) 61
BspACI CCGC 1 cut(s) 97
BspANI GGCC 1 cut(s) 67
BspCNI CTCAG 2 cut(s) 29, 225
BspT104I TTCGAA 1 cut(s) 61
Bst6I CTCTTC 2 cut(s) 107, 213
BstBI TTCGAA 1 cut(s) 61
BstDEI CTNAG 2 cut(s) 16, 233
BsuRI GGCC 1 cut(s) 67
CviAII CATG 2 cut(s) 30, 196
CviJI RGCY 6 cut(s) 67, 190, 232, 272, 286, 301
CviKI_1 RGCY 6 cut(s) 67, 190, 232, 272, 286, 301
DdeI CTNAG 2 cut(s) 16, 233
Eam1104I CTCTTC 2 cut(s) 107, 213
EarI CTCTTC 2 cut(s) 107, 213
Eco57I CTGAAG 1 cut(s) 206
FaeI CATG 2 cut(s) 33, 199
FaiI YATR 6 cut(s) 8, 31, 81, 193, 197, 215
FalI AAGNNNNNCTT 2 cut(s) 234, 266
FatI CATG 2 cut(s) 29, 195
HaeIII GGCC 1 cut(s) 67
Hin1II CATG 2 cut(s) 33, 199
HinfI GANTC 2 cut(s) 25, 202
HphI GGTGA 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 19, 207
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 2 cut(s) 57, 68
HpyCH4V TGCA 2 cut(s) 33, 158
HpyF3I CTNAG 2 cut(s) 16, 233
Hsp92II CATG 2 cut(s) 33, 199
LmnI GCTCC 1 cut(s) 291
LpnPI CCDG 2 cut(s) 94, 197
MboII GAAGA 4 cut(s) 124, 230, 242, 307
MlyI GAGTC 1 cut(s) 19
MmeI TCCRAC 1 cut(s) 313
MnlI CCTC 5 cut(s) 25, 48, 108, 146, 228
MseI TTAA 1 cut(s) 101
NlaIII CATG 2 cut(s) 33, 199
NspV TTCGAA 1 cut(s) 61
PfeI GAWTC 1 cut(s) 202
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
SaqAI TTAA 1 cut(s) 101
SchI GAGTC 1 cut(s) 19
SetI ASST 7 cut(s) 157, 165, 186, 192, 234, 288, 303
SfuI TTCGAA 1 cut(s) 61
SsiI CCGC 1 cut(s) 97
TaqI TCGA 2 cut(s) 61, 88
TfiI GAWTC 1 cut(s) 202
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.