MD03G1116600.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0020369
Physical Location & Seq
Forward (+)
10442438 .. 10442755
318 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1116600.v1.1.491

Sequence Viewer

Length: 213 bp
ATGATACCTTGCACAACACCTAGTTCGCCGTGGTTTGGCCGGAAACGGCCTCGAAAGCCTCGGAGGTCGCCGGAAACTGGACTCCTAACTCGCCGGGGATTCGCCGGAAAATGCCTCGAAAGTTCCGGCCAAACTTTGAACTTGTCGATCTCCGTGTTCTTACGTCCAAAAACTTCCAACGAAGCACTCCGAGCTTCCTTGGGACCTCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.74

Weight (kDa)

11.72

Isoelectric Point (pI)

72.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020369)

Species Orthologous Gene IDs
malus_domestica MD03G1116600.v1.1
pyrus_communis pycom07g12140 pycom08g18400 pycom13g27360 pycom13g27370 pycom17g18000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 37, 127
AfiI CCNNNNNNNGG 2 cut(s) 35, 77
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 1 cut(s) 194
AluI AGCT 1 cut(s) 194
AoxI GGCC 3 cut(s) 37, 47, 127
AspS9I GGNCC 1 cut(s) 203
AsuC2I CCSGG 1 cut(s) 95
AvaII GGWCC 1 cut(s) 203
BceAI ACGGC 2 cut(s) 13, 62
BcnI CCSGG 1 cut(s) 95
BfaI CTAG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 95
Bme18I GGWCC 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 203
BmiI GGNNCC 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 95
BpuMI CCSGG 1 cut(s) 95
BsaJI CCNNGG 4 cut(s) 29, 59, 94, 198
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 77
Bse1I ACTGG 1 cut(s) 82
BseDI CCNNGG 4 cut(s) 29, 59, 94, 198
BseLI CCNNNNNNNGG 2 cut(s) 35, 77
BseNI ACTGG 1 cut(s) 82
BshFI GGCC 3 cut(s) 39, 49, 129
BsiSI CCGG 5 cut(s) 40, 71, 94, 105, 126
BslI CCNNNNNNNGG 2 cut(s) 35, 77
BsnI GGCC 3 cut(s) 39, 49, 129
Bsp143I GATC 1 cut(s) 147
BspANI GGCC 3 cut(s) 39, 49, 129
BspLI GGNNCC 1 cut(s) 204
BsrI ACTGG 1 cut(s) 82
BssECI CCNNGG 4 cut(s) 29, 59, 94, 198
BssMI GATC 1 cut(s) 147
BssT1I CCWWGG 1 cut(s) 198
BstDSI CCRYGG 1 cut(s) 29
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstMWI GCNNNNNNNGC 2 cut(s) 55, 191
BstSCI CCNGG 1 cut(s) 93
BsuRI GGCC 3 cut(s) 39, 49, 129
BtgI CCRYGG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 203
CviJI RGCY 5 cut(s) 39, 49, 58, 129, 194
CviKI_1 RGCY 5 cut(s) 39, 49, 58, 129, 194
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
EaeI YGGCCR 2 cut(s) 37, 127
Eco130I CCWWGG 1 cut(s) 198
Eco47I GGWCC 1 cut(s) 203
EcoO109I RGGNCCY 1 cut(s) 203
EcoT14I CCWWGG 1 cut(s) 198
ErhI CCWWGG 1 cut(s) 198
FspBI CTAG 1 cut(s) 21
HaeIII GGCC 3 cut(s) 39, 49, 129
HapII CCGG 5 cut(s) 40, 71, 94, 105, 126
HinfI GANTC 2 cut(s) 81, 99
HpaII CCGG 5 cut(s) 40, 71, 94, 105, 126
Hpy188I TCNGA 2 cut(s) 63, 191
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 12
HpyF10VI GCNNNNNNNGC 2 cut(s) 55, 191
HpySE526I ACGT 1 cut(s) 163
Kzo9I GATC 1 cut(s) 147
LpnPI CCDG 6 cut(s) 53, 63, 84, 107, 118, 139
MaeI CTAG 1 cut(s) 21
MaeII ACGT 1 cut(s) 163
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MlyI GAGTC 1 cut(s) 75
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 4 cut(s) 57, 60, 69, 125
MspI CCGG 5 cut(s) 40, 71, 94, 105, 126
MspR9I CCNGG 1 cut(s) 95
MwoI GCNNNNNNNGC 2 cut(s) 55, 191
NciI CCSGG 1 cut(s) 95
NdeII GATC 1 cut(s) 147
NlaIV GGNNCC 1 cut(s) 204
PfeI GAWTC 1 cut(s) 99
PleI GAGTC 1 cut(s) 75
PpsI GAGTC 1 cut(s) 75
PpuMI RGGWCCY 1 cut(s) 203
Psp5II RGGWCCY 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 204
PspPI GGNCC 1 cut(s) 203
PspPPI RGGWCCY 1 cut(s) 203
Sau3AI GATC 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 203
SchI GAGTC 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 95
SetI ASST 6 cut(s) 10, 22, 68, 166, 196, 208
SinI GGWCC 1 cut(s) 203
SspMI CTAG 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 93
StyI CCWWGG 1 cut(s) 198
TaiI ACGT 1 cut(s) 166
TaqI TCGA 3 cut(s) 52, 117, 146
TfiI GAWTC 1 cut(s) 99
TspGWI ACGGA 1 cut(s) 142
VpaK11BI GGWCC 1 cut(s) 203
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.