MD03G1120800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0021162
Physical Location & Seq
Reverse (-)
11224572 .. 11225502
931 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1120800.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGATCCACCGCCACCACAGCCAACCACGCCGCTGCTAGCCCCCGCTCCTCCTCCTTATCACCAAGCAGGATGCTTGGATTTATGTTTGTGGATTTTGTGCTGCTGCGGTATATTTAAATGTTGTTGCCCTCCACTGTTTGAGCCTGGGCCTCCTCCACCACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.85

Weight (kDa)

4.53

Isoelectric Point (pI)

82.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021162)

Species Orthologous Gene IDs
malus_domestica MD03G1120800.v1.1 MD11G1139600.v1.1
prunus_persica Prupe.6G104300_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0058491
rosa_samantha Rh5BG393300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 47
AciI CCGC 4 cut(s) 11, 32, 45, 108
AclWI GGATC 1 cut(s) 12
AjnI CCWGG 1 cut(s) 145
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 149
ApeKI GCWGC 3 cut(s) 34, 102, 105
AspS9I GGNCC 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 53
AsuNHI GCTAGC 1 cut(s) 37
BamHI GGATCC 1 cut(s) 4
BbvI GCAGC 3 cut(s) 21, 89, 92
BciT130I CCWGG 1 cut(s) 147
BfaI CTAG 1 cut(s) 38
BisI GCNGC 4 cut(s) 32, 35, 103, 106
BlsI GCNGC 4 cut(s) 33, 36, 104, 107
Bme1390I CCNGG 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 147
BmsI GCATC 1 cut(s) 62
BmtI GCTAGC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 147
BseDI CCNNGG 1 cut(s) 146
BseGI GGATG 1 cut(s) 77
BseRI GAGGAG 3 cut(s) 39, 42, 144
BseXI GCAGC 3 cut(s) 21, 89, 92
BshFI GGCC 1 cut(s) 151
BsnI GGCC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 4
BspACI CCGC 4 cut(s) 11, 32, 45, 108
BspANI GGCC 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 6
BspOI GCTAGC 1 cut(s) 41
BspPI GGATC 1 cut(s) 12
BsrBI CCGCTC 1 cut(s) 47
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 1 cut(s) 4
Bst2UI CCWGG 1 cut(s) 147
Bst4CI ACNGT 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 39
BstF5I GGATG 1 cut(s) 77
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 2 cut(s) 19, 28
BstNI CCWGG 1 cut(s) 147
BstSCI CCNGG 1 cut(s) 145
BstV1I GCAGC 3 cut(s) 21, 89, 92
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 151
BtsCI GGATG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 134
Cac8I GCNNGC 1 cut(s) 39
Cfr13I GGNCC 1 cut(s) 149
CviJI RGCY 4 cut(s) 22, 41, 145, 151
CviKI_1 RGCY 4 cut(s) 22, 41, 145, 151
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
DraI TTTAAA 1 cut(s) 118
EcoRII CCWGG 1 cut(s) 145
FaiI YATR 3 cut(s) 85, 113, 166
FauI CCCGC 1 cut(s) 52
Fnu4HI GCNGC 4 cut(s) 32, 35, 103, 106
FokI GGATG 1 cut(s) 84
Fsp4HI GCNGC 4 cut(s) 32, 35, 103, 106
FspBI CTAG 1 cut(s) 38
GluI GCNGC 4 cut(s) 32, 35, 103, 106
HaeIII GGCC 1 cut(s) 151
HphI GGTGA 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 138
HpyF10VI GCNNNNNNNGC 2 cut(s) 19, 28
Kzo9I GATC 1 cut(s) 4
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 3 cut(s) 54, 132, 159
Lsp1109I GCAGC 3 cut(s) 21, 89, 92
LweI GCATC 1 cut(s) 62
MaeI CTAG 1 cut(s) 38
MalI GATC 1 cut(s) 6
MbiI CCGCTC 1 cut(s) 47
MboI GATC 1 cut(s) 4
MflI RGATCY 1 cut(s) 4
MnlI CCTC 5 cut(s) 60, 63, 141, 162, 165
MseI TTAA 1 cut(s) 117
MspA1I CMGCKG 1 cut(s) 34
MspR9I CCNGG 1 cut(s) 147
MvaI CCWGG 1 cut(s) 147
MwoI GCNNNNNNNGC 2 cut(s) 19, 28
NdeII GATC 1 cut(s) 4
NheI GCTAGC 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 6
PkrI GCNGC 4 cut(s) 33, 36, 104, 107
Psp6I CCWGG 1 cut(s) 145
PspGI CCWGG 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 149
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 117
SatI GCNGC 4 cut(s) 32, 35, 103, 106
Sau3AI GATC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 149
ScrFI CCNGG 1 cut(s) 147
SfaNI GCATC 1 cut(s) 62
SgeI CNNG 8 cut(s) 40, 50, 56, 77, 81, 88, 158, 159
SmiI ATTTAAAT 1 cut(s) 118
SsiI CCGC 4 cut(s) 11, 32, 45, 108
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 145
SwaI ATTTAAAT 1 cut(s) 118
TaaI ACNGT 1 cut(s) 138
TauI GCSGC 1 cut(s) 34
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TscAI CASTG 1 cut(s) 141
TseI GCWGC 3 cut(s) 34, 102, 105
TspRI CASTG 1 cut(s) 141
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.