Prupe.6G104300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0021162
Physical Location & Seq
Reverse (-)
7334255 .. 7334862
608 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G104300.1

Sequence Viewer

Length: 174 bp
ATGGATCCGCCACCACCGCCTAACGCGCCGCTGCTGGCCCCAGCCCCGGCCCCGGCTCCTGCTCCCTATGATCAAGGAGGATGCTTAGAATTATTTTTGTGGATGCTGTGCTGCTGCGGTCTATGTAGATGCTGCTGCCCTCCACTCTTCGAGCCTGGTCCTCCTCCACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

5.94

Weight (kDa)

4.05

Isoelectric Point (pI)

95.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021162)

Species Orthologous Gene IDs
malus_domestica MD03G1120800.v1.1 MD11G1139600.v1.1
prunus_persica Prupe.6G104300_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0058491
rosa_samantha Rh5BG393300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 26
AciI CCGC 4 cut(s) 8, 17, 29, 117
AclWI GGATC 1 cut(s) 12
AfiI CCNNNNNNNGG 2 cut(s) 46, 52
AjnI CCWGG 1 cut(s) 154
AlwI GGATC 1 cut(s) 12
AoxI GGCC 2 cut(s) 36, 48
ApeKI GCWGC 5 cut(s) 31, 111, 114, 132, 135
AspLEI GCGC 1 cut(s) 28
AspS9I GGNCC 3 cut(s) 37, 49, 158
AsuC2I CCSGG 2 cut(s) 47, 53
AvaII GGWCC 1 cut(s) 158
BamHI GGATCC 1 cut(s) 4
BbvI GCAGC 5 cut(s) 18, 98, 101, 119, 122
BciT130I CCWGG 1 cut(s) 156
BclI TGATCA 1 cut(s) 70
BcnI CCSGG 2 cut(s) 47, 53
BisI GCNGC 6 cut(s) 29, 32, 112, 115, 133, 136
BlsI GCNGC 6 cut(s) 30, 33, 113, 116, 134, 137
Bme1390I CCNGG 3 cut(s) 47, 53, 156
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 3 cut(s) 37, 49, 158
BmiI GGNNCC 4 cut(s) 6, 39, 51, 57
BmrFI CCNGG 3 cut(s) 47, 53, 156
BmsI GCATC 3 cut(s) 71, 93, 119
BpuMI CCSGG 2 cut(s) 47, 53
BsaJI CCNNGG 2 cut(s) 45, 51
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 52
BseBI CCWGG 1 cut(s) 156
BseDI CCNNGG 2 cut(s) 45, 51
BseGI GGATG 2 cut(s) 86, 108
BseLI CCNNNNNNNGG 2 cut(s) 46, 52
BseRI GAGGAG 1 cut(s) 153
BseXI GCAGC 5 cut(s) 18, 98, 101, 119, 122
BseYI CCCAGC 1 cut(s) 40
Bsh1236I CGCG 1 cut(s) 26
BshFI GGCC 2 cut(s) 38, 50
BsiSI CCGG 2 cut(s) 47, 53
BslI CCNNNNNNNGG 2 cut(s) 46, 52
BsnI GGCC 2 cut(s) 38, 50
Bsp143I GATC 2 cut(s) 4, 70
BspACI CCGC 4 cut(s) 8, 17, 29, 117
BspANI GGCC 2 cut(s) 38, 50
BspFNI CGCG 1 cut(s) 26
BspLI GGNNCC 4 cut(s) 6, 39, 51, 57
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 2 cut(s) 45, 51
BssMI GATC 2 cut(s) 4, 70
Bst2UI CCWGG 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 85
BstF5I GGATG 2 cut(s) 86, 108
BstFNI CGCG 1 cut(s) 26
BstHHI GCGC 1 cut(s) 28
BstKTI GATC 2 cut(s) 7, 73
BstMBI GATC 2 cut(s) 4, 70
BstMWI GCNNNNNNNGC 2 cut(s) 16, 25
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 3 cut(s) 45, 51, 154
BstUI CGCG 1 cut(s) 26
BstV1I GCAGC 5 cut(s) 18, 98, 101, 119, 122
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 2 cut(s) 38, 50
BtsCI GGATG 2 cut(s) 86, 108
Cac8I GCNNGC 1 cut(s) 36
CfoI GCGC 1 cut(s) 28
Cfr13I GGNCC 3 cut(s) 37, 49, 158
CviJI RGCY 5 cut(s) 38, 44, 50, 56, 154
CviKI_1 RGCY 5 cut(s) 38, 44, 50, 56, 154
DdeI CTNAG 1 cut(s) 85
DpnI GATC 2 cut(s) 6, 72
DpnII GATC 2 cut(s) 4, 70
Eam1104I CTCTTC 1 cut(s) 152
EarI CTCTTC 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 154
FaiI YATR 2 cut(s) 69, 124
FbaI TGATCA 1 cut(s) 70
Fnu4HI GCNGC 6 cut(s) 29, 32, 112, 115, 133, 136
FokI GGATG 2 cut(s) 93, 115
Fsp4HI GCNGC 6 cut(s) 29, 32, 112, 115, 133, 136
GlaI GCGC 1 cut(s) 27
GluI GCNGC 6 cut(s) 29, 32, 112, 115, 133, 136
GsaI CCCAGC 1 cut(s) 44
HaeIII GGCC 2 cut(s) 38, 50
HapII CCGG 2 cut(s) 47, 53
HhaI GCGC 1 cut(s) 28
Hin6I GCGC 1 cut(s) 26
HinP1I GCGC 1 cut(s) 26
HpaII CCGG 2 cut(s) 47, 53
HpyF10VI GCNNNNNNNGC 2 cut(s) 16, 25
HpyF3I CTNAG 1 cut(s) 85
HspAI GCGC 1 cut(s) 26
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 2 cut(s) 4, 70
LmnI GCTCC 2 cut(s) 61, 67
LpnPI CCDG 7 cut(s) 20, 54, 60, 66, 72, 141, 168
Lsp1109I GCAGC 5 cut(s) 18, 98, 101, 119, 122
LweI GCATC 3 cut(s) 71, 93, 119
MalI GATC 2 cut(s) 6, 72
MboI GATC 2 cut(s) 4, 70
MboII GAAGA 1 cut(s) 139
MflI RGATCY 1 cut(s) 4
MluCI AATT 1 cut(s) 89
MnlI CCTC 4 cut(s) 71, 150, 171, 174
MspA1I CMGCKG 1 cut(s) 31
MspI CCGG 2 cut(s) 47, 53
MspR9I CCNGG 3 cut(s) 47, 53, 156
MvaI CCWGG 1 cut(s) 156
MvnI CGCG 1 cut(s) 26
MwoI GCNNNNNNNGC 2 cut(s) 16, 25
NciI CCSGG 2 cut(s) 47, 53
NdeII GATC 2 cut(s) 4, 70
NlaIV GGNNCC 4 cut(s) 6, 39, 51, 57
PkrI GCNGC 6 cut(s) 30, 33, 113, 116, 134, 137
Psp6I CCWGG 1 cut(s) 154
PspFI CCCAGC 1 cut(s) 40
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 4 cut(s) 6, 39, 51, 57
PspPI GGNCC 3 cut(s) 37, 49, 158
PsuI RGATCY 1 cut(s) 4
SatI GCNGC 6 cut(s) 29, 32, 112, 115, 133, 136
Sau3AI GATC 2 cut(s) 4, 70
Sau96I GGNCC 3 cut(s) 37, 49, 158
ScrFI CCNGG 3 cut(s) 47, 53, 156
SfaNI GCATC 3 cut(s) 71, 93, 119
SinI GGWCC 1 cut(s) 158
Sse9I AATT 1 cut(s) 89
SsiI CCGC 4 cut(s) 8, 17, 29, 117
StyD4I CCNGG 3 cut(s) 45, 51, 154
TaqI TCGA 1 cut(s) 150
TasI AATT 1 cut(s) 89
TauI GCSGC 1 cut(s) 31
TseI GCWGC 5 cut(s) 31, 111, 114, 132, 135
VpaK11BI GGWCC 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.